Incidental Mutation 'R6575:Hemgn'
ID523384
Institutional Source Beutler Lab
Gene Symbol Hemgn
Ensembl Gene ENSMUSG00000028332
Gene Namehemogen
Synonyms4921524M03Rik, EDAG
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6575 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location46393989-46413506 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 46395990 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 415 (M415I)
Ref Sequence ENSEMBL: ENSMUSP00000103393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071096] [ENSMUST00000107764]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071096
AA Change: M415I

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000066383
Gene: ENSMUSG00000028332
AA Change: M415I

DomainStartEndE-ValueType
low complexity region 66 81 N/A INTRINSIC
internal_repeat_1 160 256 4.18e-7 PROSPERO
low complexity region 314 326 N/A INTRINSIC
internal_repeat_1 346 436 4.18e-7 PROSPERO
low complexity region 444 455 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107764
AA Change: M415I

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103393
Gene: ENSMUSG00000028332
AA Change: M415I

DomainStartEndE-ValueType
low complexity region 66 81 N/A INTRINSIC
internal_repeat_1 160 256 4.18e-7 PROSPERO
low complexity region 314 326 N/A INTRINSIC
internal_repeat_1 346 436 4.18e-7 PROSPERO
low complexity region 444 455 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,182,817 Y1177C probably damaging Het
4933402N22Rik A T 5: 11,920,645 K62* probably null Het
Acnat1 A G 4: 49,450,785 Y109H possibly damaging Het
Adgrf3 T A 5: 30,196,524 K835N possibly damaging Het
Afg1l T C 10: 42,318,716 D360G probably damaging Het
Ap3s1 C T 18: 46,754,381 T27M probably benign Het
Atp8b4 A G 2: 126,414,364 L225P probably damaging Het
Bicra G A 7: 15,979,131 T997I probably benign Het
Bod1l T C 5: 41,838,068 R112G probably damaging Het
Cabin1 T C 10: 75,725,701 T989A possibly damaging Het
Cog1 C A 11: 113,656,061 Q494K probably benign Het
Cyb5rl T C 4: 107,085,353 Y160H probably benign Het
Dnajb8 A G 6: 88,223,075 N198D probably damaging Het
Eif3l C A 15: 79,086,578 Q351K possibly damaging Het
Esr1 T C 10: 4,966,301 probably benign Het
Fam3c G T 6: 22,329,608 A40D probably damaging Het
Fcrla A G 1: 170,922,228 S87P probably damaging Het
Glra1 A G 11: 55,520,996 Y246H probably damaging Het
Gm2056 T C 12: 88,027,347 I115T probably damaging Het
Gm45871 T A 18: 90,591,720 C361S probably damaging Het
Greb1l A G 18: 10,547,347 N1522D possibly damaging Het
Hcn4 T C 9: 58,824,152 M214T unknown Het
Heatr5b A T 17: 78,762,989 V1665E probably damaging Het
Hibadh G A 6: 52,547,028 T295I probably damaging Het
Iars T C 13: 49,725,269 L947P probably damaging Het
Icam2 G A 11: 106,378,759 T178I probably damaging Het
Lbr A G 1: 181,836,198 S86P probably damaging Het
Lipe G A 7: 25,383,324 T801I probably benign Het
Lrp6 T C 6: 134,541,971 T44A possibly damaging Het
Malrd1 A G 2: 15,842,628 H1193R probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myh10 A G 11: 68,808,850 I1671V probably benign Het
Olfr15 A G 16: 3,839,030 D19G probably benign Het
Osbpl9 T C 4: 109,072,932 D334G possibly damaging Het
Pdcd11 A G 19: 47,109,678 D801G probably damaging Het
Pfdn4 C A 2: 170,516,636 D16E probably benign Het
Pmp22 C T 11: 63,158,273 A114V probably damaging Het
Rrp9 C T 9: 106,483,579 T253I probably damaging Het
Tcrg-V4 T A 13: 19,185,080 C34S probably benign Het
Tnrc6a A G 7: 123,169,910 T308A probably damaging Het
Trhr A G 15: 44,229,206 M280V possibly damaging Het
Trp53bp1 G A 2: 121,228,603 H926Y probably damaging Het
Trpv5 A T 6: 41,675,969 I90K probably benign Het
Ttn T C 2: 76,888,915 probably benign Het
Vav1 A C 17: 57,305,280 R513S probably damaging Het
Vmn2r100 A T 17: 19,521,409 T128S probably benign Het
Zfp687 T C 3: 95,008,389 Y1024C probably damaging Het
Zfp938 C A 10: 82,225,326 G487* probably null Het
Znrf2 A G 6: 54,878,445 Y73C probably damaging Het
Other mutations in Hemgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00843:Hemgn APN 4 46396240 missense probably benign
IGL00846:Hemgn APN 4 46396171 missense possibly damaging 0.91
IGL00930:Hemgn APN 4 46396383 nonsense probably null
IGL01875:Hemgn APN 4 46396994 missense possibly damaging 0.65
IGL01937:Hemgn APN 4 46396057 missense probably damaging 1.00
IGL02217:Hemgn APN 4 46396420 missense probably damaging 0.98
IGL02325:Hemgn APN 4 46396085 missense probably benign 0.05
IGL02746:Hemgn APN 4 46400740 missense probably damaging 0.99
IGL03093:Hemgn APN 4 46396504 missense probably benign 0.26
IGL03240:Hemgn APN 4 46400732 nonsense probably null
PIT4504001:Hemgn UTSW 4 46395863 missense probably benign
R0925:Hemgn UTSW 4 46397049 missense probably damaging 0.98
R1413:Hemgn UTSW 4 46396091 missense possibly damaging 0.94
R1795:Hemgn UTSW 4 46395958 missense probably damaging 0.97
R1844:Hemgn UTSW 4 46396655 missense possibly damaging 0.85
R2152:Hemgn UTSW 4 46396607 nonsense probably null
R2169:Hemgn UTSW 4 46396417 missense possibly damaging 0.92
R2207:Hemgn UTSW 4 46396301 missense possibly damaging 0.66
R3742:Hemgn UTSW 4 46396421 missense possibly damaging 0.94
R4515:Hemgn UTSW 4 46396477 missense probably damaging 0.98
R5310:Hemgn UTSW 4 46403927 missense possibly damaging 0.77
R5445:Hemgn UTSW 4 46400738 missense probably benign 0.09
R5456:Hemgn UTSW 4 46396571 missense probably damaging 0.99
R6520:Hemgn UTSW 4 46396466 missense probably damaging 0.98
R6983:Hemgn UTSW 4 46395997 missense possibly damaging 0.92
R7204:Hemgn UTSW 4 46397054 missense possibly damaging 0.94
R7443:Hemgn UTSW 4 46396145 missense probably damaging 0.96
R7567:Hemgn UTSW 4 46397034 missense probably damaging 0.96
R7623:Hemgn UTSW 4 46396504 missense probably benign 0.07
R8181:Hemgn UTSW 4 46396504 missense possibly damaging 0.52
Z1177:Hemgn UTSW 4 46400693 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TTGAAATAACTGGCCACTGTCC -3'
(R):5'- CACCAAGAAGCAGTTGAACCTG -3'

Sequencing Primer
(F):5'- GCTCTAAATCACAAATCCTGAGGGAG -3'
(R):5'- GAACCTGAATTCATTTCTCACGAGAC -3'
Posted On2018-06-22