Incidental Mutation 'R6575:Acnat1'
ID523385
Institutional Source Beutler Lab
Gene Symbol Acnat1
Ensembl Gene ENSMUSG00000070985
Gene Nameacyl-coenzyme A amino acid N-acyltransferase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6575 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location49447105-49473912 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49450785 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 109 (Y109H)
Ref Sequence ENSEMBL: ENSMUSP00000103325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095086] [ENSMUST00000107697] [ENSMUST00000135976]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095086
AA Change: Y109H

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092702
Gene: ENSMUSG00000070985
AA Change: Y109H

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 15 144 2.2e-44 PFAM
low complexity region 149 162 N/A INTRINSIC
Pfam:Abhydrolase_5 170 360 3.6e-8 PFAM
Pfam:FSH1 191 361 4.5e-7 PFAM
Pfam:BAAT_C 206 411 5.5e-75 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000107697
AA Change: Y109H

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103325
Gene: ENSMUSG00000070985
AA Change: Y109H

DomainStartEndE-ValueType
Pfam:Bile_Hydr_Trans 14 145 5.7e-42 PFAM
Pfam:Abhydrolase_5 156 342 3.3e-8 PFAM
Pfam:BAAT_C 188 393 1.6e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135976
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,182,817 Y1177C probably damaging Het
4933402N22Rik A T 5: 11,920,645 K62* probably null Het
Adgrf3 T A 5: 30,196,524 K835N possibly damaging Het
Afg1l T C 10: 42,318,716 D360G probably damaging Het
Ap3s1 C T 18: 46,754,381 T27M probably benign Het
Atp8b4 A G 2: 126,414,364 L225P probably damaging Het
Bicra G A 7: 15,979,131 T997I probably benign Het
Bod1l T C 5: 41,838,068 R112G probably damaging Het
Cabin1 T C 10: 75,725,701 T989A possibly damaging Het
Cog1 C A 11: 113,656,061 Q494K probably benign Het
Cyb5rl T C 4: 107,085,353 Y160H probably benign Het
Dnajb8 A G 6: 88,223,075 N198D probably damaging Het
Eif3l C A 15: 79,086,578 Q351K possibly damaging Het
Esr1 T C 10: 4,966,301 probably benign Het
Fam3c G T 6: 22,329,608 A40D probably damaging Het
Fcrla A G 1: 170,922,228 S87P probably damaging Het
Glra1 A G 11: 55,520,996 Y246H probably damaging Het
Gm2056 T C 12: 88,027,347 I115T probably damaging Het
Gm45871 T A 18: 90,591,720 C361S probably damaging Het
Greb1l A G 18: 10,547,347 N1522D possibly damaging Het
Hcn4 T C 9: 58,824,152 M214T unknown Het
Heatr5b A T 17: 78,762,989 V1665E probably damaging Het
Hemgn C A 4: 46,395,990 M415I possibly damaging Het
Hibadh G A 6: 52,547,028 T295I probably damaging Het
Iars T C 13: 49,725,269 L947P probably damaging Het
Icam2 G A 11: 106,378,759 T178I probably damaging Het
Lbr A G 1: 181,836,198 S86P probably damaging Het
Lipe G A 7: 25,383,324 T801I probably benign Het
Lrp6 T C 6: 134,541,971 T44A possibly damaging Het
Malrd1 A G 2: 15,842,628 H1193R probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myh10 A G 11: 68,808,850 I1671V probably benign Het
Olfr15 A G 16: 3,839,030 D19G probably benign Het
Osbpl9 T C 4: 109,072,932 D334G possibly damaging Het
Pdcd11 A G 19: 47,109,678 D801G probably damaging Het
Pfdn4 C A 2: 170,516,636 D16E probably benign Het
Pmp22 C T 11: 63,158,273 A114V probably damaging Het
Rrp9 C T 9: 106,483,579 T253I probably damaging Het
Tcrg-V4 T A 13: 19,185,080 C34S probably benign Het
Tnrc6a A G 7: 123,169,910 T308A probably damaging Het
Trhr A G 15: 44,229,206 M280V possibly damaging Het
Trp53bp1 G A 2: 121,228,603 H926Y probably damaging Het
Trpv5 A T 6: 41,675,969 I90K probably benign Het
Ttn T C 2: 76,888,915 probably benign Het
Vav1 A C 17: 57,305,280 R513S probably damaging Het
Vmn2r100 A T 17: 19,521,409 T128S probably benign Het
Zfp687 T C 3: 95,008,389 Y1024C probably damaging Het
Zfp938 C A 10: 82,225,326 G487* probably null Het
Znrf2 A G 6: 54,878,445 Y73C probably damaging Het
Other mutations in Acnat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02733:Acnat1 APN 4 49447793 missense probably benign
IGL03241:Acnat1 APN 4 49447702 missense probably benign 0.01
R0478:Acnat1 UTSW 4 49450901 missense probably damaging 1.00
R0568:Acnat1 UTSW 4 49451003 missense possibly damaging 0.93
R1299:Acnat1 UTSW 4 49450925 missense possibly damaging 0.94
R1538:Acnat1 UTSW 4 49447835 missense possibly damaging 0.69
R1750:Acnat1 UTSW 4 49451042 missense probably benign 0.08
R1847:Acnat1 UTSW 4 49447716 missense possibly damaging 0.71
R1913:Acnat1 UTSW 4 49447498 missense probably damaging 1.00
R2401:Acnat1 UTSW 4 49451077 missense possibly damaging 0.72
R3195:Acnat1 UTSW 4 49447457 missense probably damaging 1.00
R3196:Acnat1 UTSW 4 49447457 missense probably damaging 1.00
R3948:Acnat1 UTSW 4 49447477 missense possibly damaging 0.52
R4395:Acnat1 UTSW 4 49447679 missense probably benign 0.00
R4598:Acnat1 UTSW 4 49450781 missense probably benign 0.22
R4774:Acnat1 UTSW 4 49450784 missense probably benign 0.08
R7545:Acnat1 UTSW 4 49449142 nonsense probably null
R7891:Acnat1 UTSW 4 49449181 missense possibly damaging 0.89
R7974:Acnat1 UTSW 4 49449181 missense possibly damaging 0.89
Z1088:Acnat1 UTSW 4 49447588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTAACGGATTTCTACACCTATTTCC -3'
(R):5'- TGTGTTCCAATCCCAAGCC -3'

Sequencing Primer
(F):5'- GGATTTCTACACCTATTTCCATACAC -3'
(R):5'- CTTCTACAAGACTAACGAGGCTGG -3'
Posted On2018-06-22