Incidental Mutation 'R6575:Adgrf3'
ID523389
Institutional Source Beutler Lab
Gene Symbol Adgrf3
Ensembl Gene ENSMUSG00000067642
Gene Nameadhesion G protein-coupled receptor F3
SynonymsGpr113, LOC381628, PGR23
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6575 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location30193431-30205722 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30196524 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 835 (K835N)
Ref Sequence ENSEMBL: ENSMUSP00000085440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088117] [ENSMUST00000125367]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088117
AA Change: K835N

PolyPhen 2 Score 0.720 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000085440
Gene: ENSMUSG00000067642
AA Change: K835N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 85 97 N/A INTRINSIC
Blast:IG 163 252 2e-20 BLAST
Blast:CCP 341 399 1e-6 BLAST
low complexity region 403 415 N/A INTRINSIC
low complexity region 471 483 N/A INTRINSIC
GPS 632 684 2.68e-17 SMART
Pfam:7tm_2 687 935 1e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125367
SMART Domains Protein: ENSMUSP00000120958
Gene: ENSMUSG00000067642

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,182,817 Y1177C probably damaging Het
4933402N22Rik A T 5: 11,920,645 K62* probably null Het
Acnat1 A G 4: 49,450,785 Y109H possibly damaging Het
Afg1l T C 10: 42,318,716 D360G probably damaging Het
Ap3s1 C T 18: 46,754,381 T27M probably benign Het
Atp8b4 A G 2: 126,414,364 L225P probably damaging Het
Bicra G A 7: 15,979,131 T997I probably benign Het
Bod1l T C 5: 41,838,068 R112G probably damaging Het
Cabin1 T C 10: 75,725,701 T989A possibly damaging Het
Cog1 C A 11: 113,656,061 Q494K probably benign Het
Cyb5rl T C 4: 107,085,353 Y160H probably benign Het
Dnajb8 A G 6: 88,223,075 N198D probably damaging Het
Eif3l C A 15: 79,086,578 Q351K possibly damaging Het
Esr1 T C 10: 4,966,301 probably benign Het
Fam3c G T 6: 22,329,608 A40D probably damaging Het
Fcrla A G 1: 170,922,228 S87P probably damaging Het
Glra1 A G 11: 55,520,996 Y246H probably damaging Het
Gm2056 T C 12: 88,027,347 I115T probably damaging Het
Gm45871 T A 18: 90,591,720 C361S probably damaging Het
Greb1l A G 18: 10,547,347 N1522D possibly damaging Het
Hcn4 T C 9: 58,824,152 M214T unknown Het
Heatr5b A T 17: 78,762,989 V1665E probably damaging Het
Hemgn C A 4: 46,395,990 M415I possibly damaging Het
Hibadh G A 6: 52,547,028 T295I probably damaging Het
Iars T C 13: 49,725,269 L947P probably damaging Het
Icam2 G A 11: 106,378,759 T178I probably damaging Het
Lbr A G 1: 181,836,198 S86P probably damaging Het
Lipe G A 7: 25,383,324 T801I probably benign Het
Lrp6 T C 6: 134,541,971 T44A possibly damaging Het
Malrd1 A G 2: 15,842,628 H1193R probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myh10 A G 11: 68,808,850 I1671V probably benign Het
Olfr15 A G 16: 3,839,030 D19G probably benign Het
Osbpl9 T C 4: 109,072,932 D334G possibly damaging Het
Pdcd11 A G 19: 47,109,678 D801G probably damaging Het
Pfdn4 C A 2: 170,516,636 D16E probably benign Het
Pmp22 C T 11: 63,158,273 A114V probably damaging Het
Rrp9 C T 9: 106,483,579 T253I probably damaging Het
Tcrg-V4 T A 13: 19,185,080 C34S probably benign Het
Tnrc6a A G 7: 123,169,910 T308A probably damaging Het
Trhr A G 15: 44,229,206 M280V possibly damaging Het
Trp53bp1 G A 2: 121,228,603 H926Y probably damaging Het
Trpv5 A T 6: 41,675,969 I90K probably benign Het
Ttn T C 2: 76,888,915 probably benign Het
Vav1 A C 17: 57,305,280 R513S probably damaging Het
Vmn2r100 A T 17: 19,521,409 T128S probably benign Het
Zfp687 T C 3: 95,008,389 Y1024C probably damaging Het
Zfp938 C A 10: 82,225,326 G487* probably null Het
Znrf2 A G 6: 54,878,445 Y73C probably damaging Het
Other mutations in Adgrf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03080:Adgrf3 APN 5 30196829 missense probably benign 0.02
IGL03171:Adgrf3 APN 5 30196294 missense probably damaging 1.00
R0010:Adgrf3 UTSW 5 30205609 splice site probably benign
R0042:Adgrf3 UTSW 5 30197428 missense probably damaging 1.00
R0140:Adgrf3 UTSW 5 30196381 missense probably benign 0.19
R0617:Adgrf3 UTSW 5 30195080 missense probably benign 0.25
R0748:Adgrf3 UTSW 5 30196876 missense probably damaging 1.00
R1291:Adgrf3 UTSW 5 30199534 missense probably damaging 0.99
R1330:Adgrf3 UTSW 5 30195095 missense probably benign 0.24
R1468:Adgrf3 UTSW 5 30202229 splice site probably benign
R1695:Adgrf3 UTSW 5 30203555 missense probably benign 0.05
R1716:Adgrf3 UTSW 5 30197551 missense probably benign 0.03
R1844:Adgrf3 UTSW 5 30199213 missense probably damaging 0.96
R1935:Adgrf3 UTSW 5 30202306 missense probably benign 0.00
R1936:Adgrf3 UTSW 5 30202306 missense probably benign 0.00
R2059:Adgrf3 UTSW 5 30199491 missense possibly damaging 0.91
R2656:Adgrf3 UTSW 5 30196438 missense possibly damaging 0.96
R2913:Adgrf3 UTSW 5 30196994 missense probably damaging 1.00
R2914:Adgrf3 UTSW 5 30196994 missense probably damaging 1.00
R2987:Adgrf3 UTSW 5 30197360 missense probably damaging 1.00
R3797:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3798:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3799:Adgrf3 UTSW 5 30196823 missense possibly damaging 0.49
R3934:Adgrf3 UTSW 5 30200434 unclassified probably benign
R4043:Adgrf3 UTSW 5 30204362 missense probably benign 0.00
R4080:Adgrf3 UTSW 5 30197369 nonsense probably null
R4575:Adgrf3 UTSW 5 30202257 missense probably benign 0.00
R4754:Adgrf3 UTSW 5 30197617 critical splice acceptor site probably null
R4819:Adgrf3 UTSW 5 30198444 missense possibly damaging 0.66
R4893:Adgrf3 UTSW 5 30200478 missense probably benign 0.00
R4991:Adgrf3 UTSW 5 30199148 missense probably benign 0.26
R5686:Adgrf3 UTSW 5 30197306 missense probably damaging 1.00
R5965:Adgrf3 UTSW 5 30205639 missense probably benign 0.00
R5997:Adgrf3 UTSW 5 30198362 critical splice donor site probably null
R6103:Adgrf3 UTSW 5 30196267 missense probably damaging 1.00
R6244:Adgrf3 UTSW 5 30197533 missense probably benign 0.17
R6409:Adgrf3 UTSW 5 30197314 missense probably damaging 0.96
R6745:Adgrf3 UTSW 5 30203603 missense probably benign 0.31
R6790:Adgrf3 UTSW 5 30196387 missense probably benign 0.00
R6813:Adgrf3 UTSW 5 30197521 missense probably damaging 0.96
R7202:Adgrf3 UTSW 5 30204380 nonsense probably null
R7250:Adgrf3 UTSW 5 30195682 missense probably damaging 1.00
R7353:Adgrf3 UTSW 5 30198497 missense probably damaging 0.98
R7634:Adgrf3 UTSW 5 30202247 missense probably benign 0.01
R7658:Adgrf3 UTSW 5 30197206 missense probably benign 0.41
R8037:Adgrf3 UTSW 5 30199512 missense probably damaging 1.00
Z1088:Adgrf3 UTSW 5 30199120 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CCCAAGTGAGGCCAAAGATG -3'
(R):5'- CTGATCTGCCTAGTCACTGC -3'

Sequencing Primer
(F):5'- CCAAAGATGGGTGTGAGAATAAGC -3'
(R):5'- ACCTTTTTCTGGATGCTGGCAC -3'
Posted On2018-06-22