Incidental Mutation 'R6575:Zfp938'
ID523406
Institutional Source Beutler Lab
Gene Symbol Zfp938
Ensembl Gene ENSMUSG00000062931
Gene Namezinc finger protein 938
SynonymsB230315N10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R6575 (G1)
Quality Score134.008
Status Not validated
Chromosome10
Chromosomal Location82224850-82241280 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 82225326 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 487 (G487*)
Ref Sequence ENSEMBL: ENSMUSP00000047110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041264] [ENSMUST00000156218]
Predicted Effect probably null
Transcript: ENSMUST00000041264
AA Change: G487*
SMART Domains Protein: ENSMUSP00000047110
Gene: ENSMUSG00000062931
AA Change: G487*

DomainStartEndE-ValueType
KRAB 4 64 5.28e-14 SMART
ZnF_C2H2 161 188 2.82e1 SMART
ZnF_C2H2 267 289 1.23e0 SMART
ZnF_C2H2 295 317 2.91e-2 SMART
ZnF_C2H2 323 345 2.4e-3 SMART
ZnF_C2H2 351 373 7.26e-3 SMART
ZnF_C2H2 379 401 4.65e-1 SMART
ZnF_C2H2 407 429 1.47e-3 SMART
ZnF_C2H2 435 457 5.59e-4 SMART
ZnF_C2H2 463 485 1.82e-3 SMART
ZnF_C2H2 491 513 3.63e-3 SMART
ZnF_C2H2 519 541 7.67e-2 SMART
ZnF_C2H2 547 569 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156218
SMART Domains Protein: ENSMUSP00000121613
Gene: ENSMUSG00000062931

DomainStartEndE-ValueType
KRAB 4 64 5.28e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,182,817 Y1177C probably damaging Het
4933402N22Rik A T 5: 11,920,645 K62* probably null Het
Acnat1 A G 4: 49,450,785 Y109H possibly damaging Het
Adgrf3 T A 5: 30,196,524 K835N possibly damaging Het
Afg1l T C 10: 42,318,716 D360G probably damaging Het
Ap3s1 C T 18: 46,754,381 T27M probably benign Het
Atp8b4 A G 2: 126,414,364 L225P probably damaging Het
Bicra G A 7: 15,979,131 T997I probably benign Het
Bod1l T C 5: 41,838,068 R112G probably damaging Het
Cabin1 T C 10: 75,725,701 T989A possibly damaging Het
Cog1 C A 11: 113,656,061 Q494K probably benign Het
Cyb5rl T C 4: 107,085,353 Y160H probably benign Het
Dnajb8 A G 6: 88,223,075 N198D probably damaging Het
Eif3l C A 15: 79,086,578 Q351K possibly damaging Het
Esr1 T C 10: 4,966,301 probably benign Het
Fam3c G T 6: 22,329,608 A40D probably damaging Het
Fcrla A G 1: 170,922,228 S87P probably damaging Het
Glra1 A G 11: 55,520,996 Y246H probably damaging Het
Gm2056 T C 12: 88,027,347 I115T probably damaging Het
Gm45871 T A 18: 90,591,720 C361S probably damaging Het
Greb1l A G 18: 10,547,347 N1522D possibly damaging Het
Hcn4 T C 9: 58,824,152 M214T unknown Het
Heatr5b A T 17: 78,762,989 V1665E probably damaging Het
Hemgn C A 4: 46,395,990 M415I possibly damaging Het
Hibadh G A 6: 52,547,028 T295I probably damaging Het
Iars T C 13: 49,725,269 L947P probably damaging Het
Icam2 G A 11: 106,378,759 T178I probably damaging Het
Lbr A G 1: 181,836,198 S86P probably damaging Het
Lipe G A 7: 25,383,324 T801I probably benign Het
Lrp6 T C 6: 134,541,971 T44A possibly damaging Het
Malrd1 A G 2: 15,842,628 H1193R probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myh10 A G 11: 68,808,850 I1671V probably benign Het
Olfr15 A G 16: 3,839,030 D19G probably benign Het
Osbpl9 T C 4: 109,072,932 D334G possibly damaging Het
Pdcd11 A G 19: 47,109,678 D801G probably damaging Het
Pfdn4 C A 2: 170,516,636 D16E probably benign Het
Pmp22 C T 11: 63,158,273 A114V probably damaging Het
Rrp9 C T 9: 106,483,579 T253I probably damaging Het
Tcrg-V4 T A 13: 19,185,080 C34S probably benign Het
Tnrc6a A G 7: 123,169,910 T308A probably damaging Het
Trhr A G 15: 44,229,206 M280V possibly damaging Het
Trp53bp1 G A 2: 121,228,603 H926Y probably damaging Het
Trpv5 A T 6: 41,675,969 I90K probably benign Het
Ttn T C 2: 76,888,915 probably benign Het
Vav1 A C 17: 57,305,280 R513S probably damaging Het
Vmn2r100 A T 17: 19,521,409 T128S probably benign Het
Zfp687 T C 3: 95,008,389 Y1024C probably damaging Het
Znrf2 A G 6: 54,878,445 Y73C probably damaging Het
Other mutations in Zfp938
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Zfp938 APN 10 82227521 utr 3 prime probably benign
IGL00743:Zfp938 APN 10 82226483 missense probably benign
IGL01764:Zfp938 APN 10 82227790 splice site probably benign
IGL01814:Zfp938 APN 10 82226218 missense probably benign
IGL02244:Zfp938 APN 10 82226072 missense possibly damaging 0.86
IGL02865:Zfp938 APN 10 82226192 missense probably benign 0.33
R0372:Zfp938 UTSW 10 82227828 missense probably damaging 1.00
R0666:Zfp938 UTSW 10 82225772 missense probably damaging 1.00
R0964:Zfp938 UTSW 10 82225419 missense probably benign 0.00
R1453:Zfp938 UTSW 10 82227798 critical splice donor site probably null
R1672:Zfp938 UTSW 10 82225148 missense probably benign
R1929:Zfp938 UTSW 10 82225547 missense probably damaging 1.00
R1959:Zfp938 UTSW 10 82225631 missense probably damaging 1.00
R2127:Zfp938 UTSW 10 82226042 missense probably benign
R2271:Zfp938 UTSW 10 82225547 missense probably damaging 1.00
R2900:Zfp938 UTSW 10 82225506 missense possibly damaging 0.92
R4502:Zfp938 UTSW 10 82226271 missense possibly damaging 0.73
R4503:Zfp938 UTSW 10 82226271 missense possibly damaging 0.73
R4886:Zfp938 UTSW 10 82226123 missense probably benign 0.33
R4934:Zfp938 UTSW 10 82226178 missense possibly damaging 0.86
R5174:Zfp938 UTSW 10 82226004 missense possibly damaging 0.53
R5410:Zfp938 UTSW 10 82225258 missense possibly damaging 0.89
R6284:Zfp938 UTSW 10 82227566 missense possibly damaging 0.73
R6491:Zfp938 UTSW 10 82227529 makesense probably null
R6649:Zfp938 UTSW 10 82225398 missense probably damaging 0.99
X0066:Zfp938 UTSW 10 82226097 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- ATCTCATTTACTATCCTTCAGGGG -3'
(R):5'- CCTTTGCACGTAACAGCCATG -3'

Sequencing Primer
(F):5'- TACCAAGATGTGCAAAGGATATACC -3'
(R):5'- CAGCCATGTTAAAATGCATGAAAG -3'
Posted On2018-06-22