Incidental Mutation 'R6575:Pmp22'
ID523408
Institutional Source Beutler Lab
Gene Symbol Pmp22
Ensembl Gene ENSMUSG00000018217
Gene Nameperipheral myelin protein 22
SynonymsGas-3
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_008885.2; MGI:97631

Is this an essential gene? Possibly non essential (E-score: 0.341) question?
Stock #R6575 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location63128982-63159547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 63158273 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 114 (A114V)
Ref Sequence ENSEMBL: ENSMUSP00000104342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018361] [ENSMUST00000108700] [ENSMUST00000108701] [ENSMUST00000108702]
Predicted Effect probably damaging
Transcript: ENSMUST00000018361
AA Change: A114V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018361
Gene: ENSMUSG00000018217
AA Change: A114V

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.8e-50 PFAM
Pfam:Claudin_2 13 155 1.1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108700
AA Change: A114V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104340
Gene: ENSMUSG00000018217
AA Change: A114V

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.8e-50 PFAM
Pfam:Claudin_2 13 155 1.1e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108701
AA Change: A114V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104341
Gene: ENSMUSG00000018217
AA Change: A114V

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.7e-50 PFAM
Pfam:Claudin_2 55 155 1.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108702
AA Change: A114V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104342
Gene: ENSMUSG00000018217
AA Change: A114V

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 1 153 5.8e-50 PFAM
Pfam:Claudin_2 13 155 1.1e-12 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype Strain: 2447704; 3614822
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein that is a major component of myelin in the peripheral nervous system. Studies suggest two alternately used promoters drive tissue-specific expression. Various mutations of this gene are causes of Charcot-Marie-Tooth disease Type IA, Dejerine-Sottas syndrome, and hereditary neuropathy with liability to pressure palsies. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice with one or two copies of several mutations exhibit tremors, a tendency toward seizures, and partial paralysis associated with demyelination and loss of peripheral axons. Mutants have high juvenile mortality and males are often sterile. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(4) Spontaneous(3) Chemically induced(4)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,182,817 Y1177C probably damaging Het
4933402N22Rik A T 5: 11,920,645 K62* probably null Het
Acnat1 A G 4: 49,450,785 Y109H possibly damaging Het
Adgrf3 T A 5: 30,196,524 K835N possibly damaging Het
Afg1l T C 10: 42,318,716 D360G probably damaging Het
Ap3s1 C T 18: 46,754,381 T27M probably benign Het
Atp8b4 A G 2: 126,414,364 L225P probably damaging Het
Bicra G A 7: 15,979,131 T997I probably benign Het
Bod1l T C 5: 41,838,068 R112G probably damaging Het
Cabin1 T C 10: 75,725,701 T989A possibly damaging Het
Cog1 C A 11: 113,656,061 Q494K probably benign Het
Cyb5rl T C 4: 107,085,353 Y160H probably benign Het
Dnajb8 A G 6: 88,223,075 N198D probably damaging Het
Eif3l C A 15: 79,086,578 Q351K possibly damaging Het
Esr1 T C 10: 4,966,301 probably benign Het
Fam3c G T 6: 22,329,608 A40D probably damaging Het
Fcrla A G 1: 170,922,228 S87P probably damaging Het
Glra1 A G 11: 55,520,996 Y246H probably damaging Het
Gm2056 T C 12: 88,027,347 I115T probably damaging Het
Gm45871 T A 18: 90,591,720 C361S probably damaging Het
Greb1l A G 18: 10,547,347 N1522D possibly damaging Het
Hcn4 T C 9: 58,824,152 M214T unknown Het
Heatr5b A T 17: 78,762,989 V1665E probably damaging Het
Hemgn C A 4: 46,395,990 M415I possibly damaging Het
Hibadh G A 6: 52,547,028 T295I probably damaging Het
Iars T C 13: 49,725,269 L947P probably damaging Het
Icam2 G A 11: 106,378,759 T178I probably damaging Het
Lbr A G 1: 181,836,198 S86P probably damaging Het
Lipe G A 7: 25,383,324 T801I probably benign Het
Lrp6 T C 6: 134,541,971 T44A possibly damaging Het
Malrd1 A G 2: 15,842,628 H1193R probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myh10 A G 11: 68,808,850 I1671V probably benign Het
Olfr15 A G 16: 3,839,030 D19G probably benign Het
Osbpl9 T C 4: 109,072,932 D334G possibly damaging Het
Pdcd11 A G 19: 47,109,678 D801G probably damaging Het
Pfdn4 C A 2: 170,516,636 D16E probably benign Het
Rrp9 C T 9: 106,483,579 T253I probably damaging Het
Tcrg-V4 T A 13: 19,185,080 C34S probably benign Het
Tnrc6a A G 7: 123,169,910 T308A probably damaging Het
Trhr A G 15: 44,229,206 M280V possibly damaging Het
Trp53bp1 G A 2: 121,228,603 H926Y probably damaging Het
Trpv5 A T 6: 41,675,969 I90K probably benign Het
Ttn T C 2: 76,888,915 probably benign Het
Vav1 A C 17: 57,305,280 R513S probably damaging Het
Vmn2r100 A T 17: 19,521,409 T128S probably benign Het
Zfp687 T C 3: 95,008,389 Y1024C probably damaging Het
Zfp938 C A 10: 82,225,326 G487* probably null Het
Znrf2 A G 6: 54,878,445 Y73C probably damaging Het
Other mutations in Pmp22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01780:Pmp22 APN 11 63158308 missense probably benign
IGL02350:Pmp22 APN 11 63158308 missense probably benign
IGL02357:Pmp22 APN 11 63158308 missense probably benign
IGL02423:Pmp22 APN 11 63158292 missense possibly damaging 0.94
IGL03107:Pmp22 APN 11 63158309 missense probably benign
PIT4431001:Pmp22 UTSW 11 63151241 missense probably benign 0.00
R0025:Pmp22 UTSW 11 63158250 critical splice acceptor site probably null
R0025:Pmp22 UTSW 11 63158250 critical splice acceptor site probably null
R0453:Pmp22 UTSW 11 63151103 intron probably benign
R0561:Pmp22 UTSW 11 63134424 missense probably damaging 1.00
R3858:Pmp22 UTSW 11 63134475 missense probably benign 0.00
R5107:Pmp22 UTSW 11 63158411 missense probably damaging 0.99
R6573:Pmp22 UTSW 11 63158273 missense probably damaging 1.00
R6574:Pmp22 UTSW 11 63158273 missense probably damaging 1.00
R7455:Pmp22 UTSW 11 63134513 splice site probably null
R7599:Pmp22 UTSW 11 63158348 missense probably damaging 1.00
R8008:Pmp22 UTSW 11 63158407 missense probably damaging 1.00
R8424:Pmp22 UTSW 11 63133076 intron probably benign
R8506:Pmp22 UTSW 11 63158264 missense probably damaging 1.00
R8812:Pmp22 UTSW 11 63158413 makesense probably null
Predicted Primers PCR Primer
(F):5'- TGTGCTGGACCCTCAGAGAG -3'
(R):5'- TATGCGCGCTCAGAGCCTA -3'

Sequencing Primer
(F):5'- CTCAGAGAGGGGCGTTGG -3'
(R):5'- TCAGAGCCTAGACGGACG -3'
Posted On2018-06-22