Incidental Mutation 'R6575:Icam2'
ID523410
Institutional Source Beutler Lab
Gene Symbol Icam2
Ensembl Gene ENSMUSG00000001029
Gene Nameintercellular adhesion molecule 2
SynonymsCD102, Icam-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6575 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location106377656-106388075 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106378759 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 178 (T178I)
Ref Sequence ENSEMBL: ENSMUSP00000001055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001055] [ENSMUST00000009354] [ENSMUST00000106813] [ENSMUST00000106816] [ENSMUST00000141146] [ENSMUST00000185986] [ENSMUST00000188561] [ENSMUST00000190268] [ENSMUST00000190795]
PDB Structure
Crystal structure of the radxin FERM domain complexed with the ICAM-2 cytoplasmic peptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000001055
AA Change: T178I

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000001055
Gene: ENSMUSG00000001029
AA Change: T178I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 114 8.6e-45 PFAM
Blast:IG_like 119 215 2e-36 BLAST
transmembrane domain 224 246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000009354
SMART Domains Protein: ENSMUSP00000009354
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 1 60 9.4e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106809
Predicted Effect probably benign
Transcript: ENSMUST00000106813
SMART Domains Protein: ENSMUSP00000102426
Gene: ENSMUSG00000001029

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ICAM_N 22 114 2.8e-45 PFAM
Blast:IG_like 119 161 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000106816
SMART Domains Protein: ENSMUSP00000102429
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 39 110 1.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141146
SMART Domains Protein: ENSMUSP00000118043
Gene: ENSMUSG00000001029

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ICAM_N 58 138 2.1e-39 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000173795
AA Change: T113I
SMART Domains Protein: ENSMUSP00000133315
Gene: ENSMUSG00000001029
AA Change: T113I

DomainStartEndE-ValueType
Pfam:ICAM_N 1 50 2.2e-21 PFAM
Blast:IG_like 55 151 2e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000185986
SMART Domains Protein: ENSMUSP00000140365
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 32 103 1.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188561
SMART Domains Protein: ENSMUSP00000140194
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 39 101 1.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190268
SMART Domains Protein: ENSMUSP00000139960
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 39 110 2.8e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190795
SMART Domains Protein: ENSMUSP00000140541
Gene: ENSMUSG00000009210

DomainStartEndE-ValueType
Pfam:DUF4587 1 60 9.4e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. This protein may play a role in lymphocyte recirculation by blocking LFA-1-dependent cell adhesion. It mediates adhesive interactions important for antigen-specific immune response, NK-cell mediated clearance, lymphocyte recirculation, and other cellular interactions important for immune response and surveillance. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene results in increased respiratory responsiveness due to an increased accumulation of eosinophils in the lung interstitium and a concomittant delay in the increase of eosinophils in the airway lumen during the development of an allergic inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,182,817 Y1177C probably damaging Het
4933402N22Rik A T 5: 11,920,645 K62* probably null Het
Acnat1 A G 4: 49,450,785 Y109H possibly damaging Het
Adgrf3 T A 5: 30,196,524 K835N possibly damaging Het
Afg1l T C 10: 42,318,716 D360G probably damaging Het
Ap3s1 C T 18: 46,754,381 T27M probably benign Het
Atp8b4 A G 2: 126,414,364 L225P probably damaging Het
Bicra G A 7: 15,979,131 T997I probably benign Het
Bod1l T C 5: 41,838,068 R112G probably damaging Het
Cabin1 T C 10: 75,725,701 T989A possibly damaging Het
Cog1 C A 11: 113,656,061 Q494K probably benign Het
Cyb5rl T C 4: 107,085,353 Y160H probably benign Het
Dnajb8 A G 6: 88,223,075 N198D probably damaging Het
Eif3l C A 15: 79,086,578 Q351K possibly damaging Het
Esr1 T C 10: 4,966,301 probably benign Het
Fam3c G T 6: 22,329,608 A40D probably damaging Het
Fcrla A G 1: 170,922,228 S87P probably damaging Het
Glra1 A G 11: 55,520,996 Y246H probably damaging Het
Gm2056 T C 12: 88,027,347 I115T probably damaging Het
Gm45871 T A 18: 90,591,720 C361S probably damaging Het
Greb1l A G 18: 10,547,347 N1522D possibly damaging Het
Hcn4 T C 9: 58,824,152 M214T unknown Het
Heatr5b A T 17: 78,762,989 V1665E probably damaging Het
Hemgn C A 4: 46,395,990 M415I possibly damaging Het
Hibadh G A 6: 52,547,028 T295I probably damaging Het
Iars T C 13: 49,725,269 L947P probably damaging Het
Lbr A G 1: 181,836,198 S86P probably damaging Het
Lipe G A 7: 25,383,324 T801I probably benign Het
Lrp6 T C 6: 134,541,971 T44A possibly damaging Het
Malrd1 A G 2: 15,842,628 H1193R probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myh10 A G 11: 68,808,850 I1671V probably benign Het
Olfr15 A G 16: 3,839,030 D19G probably benign Het
Osbpl9 T C 4: 109,072,932 D334G possibly damaging Het
Pdcd11 A G 19: 47,109,678 D801G probably damaging Het
Pfdn4 C A 2: 170,516,636 D16E probably benign Het
Pmp22 C T 11: 63,158,273 A114V probably damaging Het
Rrp9 C T 9: 106,483,579 T253I probably damaging Het
Tcrg-V4 T A 13: 19,185,080 C34S probably benign Het
Tnrc6a A G 7: 123,169,910 T308A probably damaging Het
Trhr A G 15: 44,229,206 M280V possibly damaging Het
Trp53bp1 G A 2: 121,228,603 H926Y probably damaging Het
Trpv5 A T 6: 41,675,969 I90K probably benign Het
Ttn T C 2: 76,888,915 probably benign Het
Vav1 A C 17: 57,305,280 R513S probably damaging Het
Vmn2r100 A T 17: 19,521,409 T128S probably benign Het
Zfp687 T C 3: 95,008,389 Y1024C probably damaging Het
Zfp938 C A 10: 82,225,326 G487* probably null Het
Znrf2 A G 6: 54,878,445 Y73C probably damaging Het
Other mutations in Icam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0646:Icam2 UTSW 11 106380891 missense probably damaging 0.97
R1651:Icam2 UTSW 11 106377956 missense probably damaging 1.00
R2026:Icam2 UTSW 11 106382442 missense probably benign 0.01
R3804:Icam2 UTSW 11 106380822 missense probably damaging 1.00
R4092:Icam2 UTSW 11 106380797 start codon destroyed probably null
R5395:Icam2 UTSW 11 106382473 splice site probably null
R6722:Icam2 UTSW 11 106382481 missense probably damaging 0.99
R7221:Icam2 UTSW 11 106382442 missense probably benign 0.01
R7579:Icam2 UTSW 11 106380763 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCAGACTACCTAGGAGTGAGGC -3'
(R):5'- AAGTCACACTGAAGCTGCAGC -3'

Sequencing Primer
(F):5'- ACTACCTAGGAGTGAGGCTCGTG -3'
(R):5'- GAAGCTGCAGCCGCCTC -3'
Posted On2018-06-22