Incidental Mutation 'R6575:Heatr5b'
ID523420
Institutional Source Beutler Lab
Gene Symbol Heatr5b
Ensembl Gene ENSMUSG00000039414
Gene NameHEAT repeat containing 5B
Synonyms2010013B10Rik, A230048G03Rik, D330050P16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R6575 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location78752906-78835381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78762989 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1665 (V1665E)
Ref Sequence ENSEMBL: ENSMUSP00000094882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097281]
Predicted Effect probably damaging
Transcript: ENSMUST00000097281
AA Change: V1665E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094882
Gene: ENSMUSG00000039414
AA Change: V1665E

DomainStartEndE-ValueType
SCOP:d1qbkb_ 46 491 4e-6 SMART
SCOP:d1qbkb_ 846 1338 2e-16 SMART
low complexity region 1641 1650 N/A INTRINSIC
low complexity region 2039 2057 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900026A02Rik T C 5: 113,182,817 Y1177C probably damaging Het
4933402N22Rik A T 5: 11,920,645 K62* probably null Het
Acnat1 A G 4: 49,450,785 Y109H possibly damaging Het
Adgrf3 T A 5: 30,196,524 K835N possibly damaging Het
Afg1l T C 10: 42,318,716 D360G probably damaging Het
Ap3s1 C T 18: 46,754,381 T27M probably benign Het
Atp8b4 A G 2: 126,414,364 L225P probably damaging Het
Bicra G A 7: 15,979,131 T997I probably benign Het
Bod1l T C 5: 41,838,068 R112G probably damaging Het
Cabin1 T C 10: 75,725,701 T989A possibly damaging Het
Cog1 C A 11: 113,656,061 Q494K probably benign Het
Cyb5rl T C 4: 107,085,353 Y160H probably benign Het
Dnajb8 A G 6: 88,223,075 N198D probably damaging Het
Eif3l C A 15: 79,086,578 Q351K possibly damaging Het
Esr1 T C 10: 4,966,301 probably benign Het
Fam3c G T 6: 22,329,608 A40D probably damaging Het
Fcrla A G 1: 170,922,228 S87P probably damaging Het
Glra1 A G 11: 55,520,996 Y246H probably damaging Het
Gm2056 T C 12: 88,027,347 I115T probably damaging Het
Gm45871 T A 18: 90,591,720 C361S probably damaging Het
Greb1l A G 18: 10,547,347 N1522D possibly damaging Het
Hcn4 T C 9: 58,824,152 M214T unknown Het
Hemgn C A 4: 46,395,990 M415I possibly damaging Het
Hibadh G A 6: 52,547,028 T295I probably damaging Het
Iars T C 13: 49,725,269 L947P probably damaging Het
Icam2 G A 11: 106,378,759 T178I probably damaging Het
Lbr A G 1: 181,836,198 S86P probably damaging Het
Lipe G A 7: 25,383,324 T801I probably benign Het
Lrp6 T C 6: 134,541,971 T44A possibly damaging Het
Malrd1 A G 2: 15,842,628 H1193R probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Myh10 A G 11: 68,808,850 I1671V probably benign Het
Olfr15 A G 16: 3,839,030 D19G probably benign Het
Osbpl9 T C 4: 109,072,932 D334G possibly damaging Het
Pdcd11 A G 19: 47,109,678 D801G probably damaging Het
Pfdn4 C A 2: 170,516,636 D16E probably benign Het
Pmp22 C T 11: 63,158,273 A114V probably damaging Het
Rrp9 C T 9: 106,483,579 T253I probably damaging Het
Tcrg-V4 T A 13: 19,185,080 C34S probably benign Het
Tnrc6a A G 7: 123,169,910 T308A probably damaging Het
Trhr A G 15: 44,229,206 M280V possibly damaging Het
Trp53bp1 G A 2: 121,228,603 H926Y probably damaging Het
Trpv5 A T 6: 41,675,969 I90K probably benign Het
Ttn T C 2: 76,888,915 probably benign Het
Vav1 A C 17: 57,305,280 R513S probably damaging Het
Vmn2r100 A T 17: 19,521,409 T128S probably benign Het
Zfp687 T C 3: 95,008,389 Y1024C probably damaging Het
Zfp938 C A 10: 82,225,326 G487* probably null Het
Znrf2 A G 6: 54,878,445 Y73C probably damaging Het
Other mutations in Heatr5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Heatr5b APN 17 78803434 missense probably damaging 1.00
IGL00418:Heatr5b APN 17 78753141 missense probably damaging 1.00
IGL00786:Heatr5b APN 17 78824634 missense possibly damaging 0.95
IGL00840:Heatr5b APN 17 78765437 missense probably damaging 1.00
IGL01362:Heatr5b APN 17 78816338 splice site probably benign
IGL01419:Heatr5b APN 17 78796510 missense probably benign 0.19
IGL01447:Heatr5b APN 17 78829597 missense probably benign 0.00
IGL01591:Heatr5b APN 17 78808472 missense probably benign 0.01
IGL01743:Heatr5b APN 17 78824640 nonsense probably null
IGL01860:Heatr5b APN 17 78808480 missense probably damaging 0.98
IGL01862:Heatr5b APN 17 78796485 missense possibly damaging 0.96
IGL01984:Heatr5b APN 17 78796497 missense possibly damaging 0.63
IGL02045:Heatr5b APN 17 78808426 missense probably damaging 1.00
IGL02097:Heatr5b APN 17 78817514 missense probably damaging 1.00
IGL02168:Heatr5b APN 17 78831591 unclassified probably benign
IGL02399:Heatr5b APN 17 78827967 missense probably damaging 0.99
IGL02540:Heatr5b APN 17 78773572 missense probably damaging 1.00
IGL02719:Heatr5b APN 17 78815540 missense probably damaging 1.00
IGL02824:Heatr5b APN 17 78773680 missense probably damaging 1.00
IGL02965:Heatr5b APN 17 78753073 missense probably benign 0.37
IGL03032:Heatr5b APN 17 78760499 missense probably benign 0.45
IGL03243:Heatr5b APN 17 78763080 splice site probably benign
IGL03259:Heatr5b APN 17 78791556 missense probably damaging 1.00
IGL03349:Heatr5b APN 17 78755320 missense probably benign 0.01
R0124:Heatr5b UTSW 17 78826217 splice site probably benign
R0285:Heatr5b UTSW 17 78808453 missense probably benign 0.05
R0335:Heatr5b UTSW 17 78827946 missense probably benign 0.15
R0412:Heatr5b UTSW 17 78820854 missense probably benign 0.04
R0601:Heatr5b UTSW 17 78768545 missense probably benign
R0725:Heatr5b UTSW 17 78796396 missense probably benign 0.03
R1178:Heatr5b UTSW 17 78813269 missense probably damaging 1.00
R1444:Heatr5b UTSW 17 78753193 missense probably benign 0.17
R1444:Heatr5b UTSW 17 78755427 splice site probably benign
R1453:Heatr5b UTSW 17 78817563 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1469:Heatr5b UTSW 17 78808384 missense probably damaging 1.00
R1506:Heatr5b UTSW 17 78753147 missense probably damaging 1.00
R1819:Heatr5b UTSW 17 78791511 missense probably damaging 0.98
R1835:Heatr5b UTSW 17 78773563 missense probably damaging 1.00
R1837:Heatr5b UTSW 17 78820751 missense possibly damaging 0.54
R1934:Heatr5b UTSW 17 78795918 missense possibly damaging 0.93
R2014:Heatr5b UTSW 17 78814184 missense probably damaging 1.00
R2037:Heatr5b UTSW 17 78829505 nonsense probably null
R2154:Heatr5b UTSW 17 78831444 missense probably benign 0.00
R2190:Heatr5b UTSW 17 78801756 missense probably damaging 1.00
R2191:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R2413:Heatr5b UTSW 17 78756861 critical splice donor site probably null
R3424:Heatr5b UTSW 17 78768404 missense possibly damaging 0.58
R3607:Heatr5b UTSW 17 78834217 missense probably damaging 1.00
R3759:Heatr5b UTSW 17 78824540 missense possibly damaging 0.94
R3761:Heatr5b UTSW 17 78829642 missense probably damaging 1.00
R4127:Heatr5b UTSW 17 78753174 missense possibly damaging 0.48
R4242:Heatr5b UTSW 17 78756922 missense probably benign 0.00
R4345:Heatr5b UTSW 17 78760511 missense possibly damaging 0.94
R4534:Heatr5b UTSW 17 78810596 missense possibly damaging 0.91
R4623:Heatr5b UTSW 17 78795119 missense possibly damaging 0.52
R4654:Heatr5b UTSW 17 78820701 missense possibly damaging 0.95
R4939:Heatr5b UTSW 17 78762260 missense probably benign 0.18
R4960:Heatr5b UTSW 17 78831584 missense probably benign 0.01
R5037:Heatr5b UTSW 17 78824510 missense probably benign 0.00
R5051:Heatr5b UTSW 17 78795274 missense probably damaging 1.00
R5153:Heatr5b UTSW 17 78795107 nonsense probably null
R5328:Heatr5b UTSW 17 78826362 missense possibly damaging 0.94
R5346:Heatr5b UTSW 17 78827986 missense probably benign 0.44
R5426:Heatr5b UTSW 17 78773713 missense probably damaging 1.00
R5470:Heatr5b UTSW 17 78821579 splice site probably null
R5472:Heatr5b UTSW 17 78801660 missense probably damaging 1.00
R5553:Heatr5b UTSW 17 78753351 splice site probably null
R5706:Heatr5b UTSW 17 78766875 splice site probably null
R5804:Heatr5b UTSW 17 78831522 missense probably damaging 0.97
R5978:Heatr5b UTSW 17 78806036 missense probably damaging 0.99
R6122:Heatr5b UTSW 17 78813173 missense possibly damaging 0.96
R6153:Heatr5b UTSW 17 78831441 missense possibly damaging 0.56
R6220:Heatr5b UTSW 17 78773677 missense probably damaging 1.00
R6221:Heatr5b UTSW 17 78766954 missense probably benign 0.05
R6255:Heatr5b UTSW 17 78803434 missense probably damaging 1.00
R6291:Heatr5b UTSW 17 78762097 missense probably benign 0.08
R6455:Heatr5b UTSW 17 78753073 missense probably benign 0.37
R6524:Heatr5b UTSW 17 78814106 missense possibly damaging 0.94
R6899:Heatr5b UTSW 17 78803509 missense probably benign 0.03
R7084:Heatr5b UTSW 17 78810563 missense possibly damaging 0.68
R7138:Heatr5b UTSW 17 78827988 missense probably damaging 1.00
R7148:Heatr5b UTSW 17 78831434 missense probably damaging 0.99
R7382:Heatr5b UTSW 17 78803507 missense possibly damaging 0.64
R7420:Heatr5b UTSW 17 78808480 missense probably damaging 1.00
R7436:Heatr5b UTSW 17 78768533 missense probably benign
R7519:Heatr5b UTSW 17 78755217 missense probably benign
R7606:Heatr5b UTSW 17 78763026 missense probably benign
R7673:Heatr5b UTSW 17 78795983 missense probably damaging 0.97
R7782:Heatr5b UTSW 17 78795941 missense probably damaging 0.99
R7790:Heatr5b UTSW 17 78818823 missense probably damaging 0.99
X0022:Heatr5b UTSW 17 78760545 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TGACACCTTTGAATGGACGAAG -3'
(R):5'- AAATCTTATAGGACAAAGTGTGACC -3'

Sequencing Primer
(F):5'- ACAGGTCCTCTATCTGGTGATGAAC -3'
(R):5'- GTACCCATCTGTCATTTGAAA -3'
Posted On2018-06-22