Mutagenetix > Incidental Mutations

Incidental Mutation 'R6581:Gbp2b'

523428

Institutional Source

Beutler Lab

Gene Symbol

Gbp2b

Ensembl Gene

ENSMUSG00000040264

Gene Name

guanylate binding protein 2b

Synonyms

Gbp1, Mpa1, Mag-1, Gbp-1, Mpa-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6581 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

142594847-142619179 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 142608238 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 426 (Y426*)

Ref Sequence

ENSEMBL: ENSMUSP00000029936 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029936]

Predicted Effect

probably null
Transcript: ENSMUST00000029936
AA Change: Y426*

SMART Domains

Protein: ENSMUSP00000029936
Gene: ENSMUSG00000040264
AA Change: Y426*

Domain	Start	End	E-Value	Type
Pfam:GBP	18	280	4.1e-122	PFAM
Pfam:GBP_C	282	578	5.5e-125	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanylate-binding protein (GBP) family. GBPs specifically bind guanine nucleotides (GMP, GDP, and GTP) and contain two of the three consensus motifs found in typical GTP-binding proteins. The encoded protein interacts with a member of the germinal center kinase family. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased susceptibility to bacterial infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 27 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aldh8a1	G	A	10: 21,380,842	V51M	probably damaging	Het
Armc4	C	T	18: 7,129,560	V873I	possibly damaging	Het
Cdh17	A	T	4: 11,799,615	I471F	probably damaging	Het
Dnajb7	T	A	15: 81,408,025	E37V	probably damaging	Het
Dpy19l1	T	A	9: 24,447,864	I337F	possibly damaging	Het
Etv5	C	T	16: 22,439,699		probably benign	Het
Gm21103	A	T	14: 6,303,815	N78K	probably damaging	Het
Helz2	A	G	2: 181,229,379	V2755A	probably damaging	Het
Itga9	A	T	9: 118,658,564	E238D	probably benign	Het
Itgb8	A	T	12: 119,163,215	C736S	probably benign	Het
Luzp1	A	G	4: 136,540,631	E55G	probably damaging	Het
Mkl1	A	G	15: 81,016,373	L589P	probably damaging	Het
Ms4a4d	G	A	19: 11,554,840	V117M	probably damaging	Het
Olfr411	A	G	11: 74,347,206	F126S	probably damaging	Het
Olfr453	T	C	6: 42,744,079	L14P	probably damaging	Het
Olfr69	T	C	7: 103,768,221	I59V	probably benign	Het
Prl7a1	A	T	13: 27,633,629	D217E	probably damaging	Het
Slc12a5	T	C	2: 164,987,115	F525S	probably damaging	Het
Smyd5	G	A	6: 85,432,023	D7N	probably damaging	Het
Spata18	G	T	5: 73,669,516	R152L	probably benign	Het
Thbd	A	G	2: 148,406,272	S559P	probably benign	Het
Tiam2	CGGG	CGGGG	17: 3,414,622		probably null	Het
Tnpo2	C	A	8: 85,055,404	P874Q	probably damaging	Het
Uchl4	A	T	9: 64,235,793	E185D	possibly damaging	Het
Vmn1r158	G	A	7: 22,790,040	T248I	possibly damaging	Het
Vmn1r5	T	C	6: 56,985,381	F14L	probably benign	Het
Yaf2	T	C	15: 93,286,414	T101A	probably benign	Het

Other mutations in Gbp2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01637:Gbp2b	APN	3	142598312	missense	probably damaging	1.00
IGL01892:Gbp2b	APN	3	142603620	missense	probably benign	0.03
IGL01989:Gbp2b	APN	3	142611440	missense	probably benign	0.19
IGL02019:Gbp2b	APN	3	142606990	missense	possibly damaging	0.52
IGL02338:Gbp2b	APN	3	142604226	missense	probably benign	0.09
IGL02657:Gbp2b	APN	3	142604112	missense	probably damaging	1.00
IGL03148:Gbp2b	APN	3	142606881	missense	probably benign	0.00
FR4304:Gbp2b	UTSW	3	142603652	missense	probably benign	0.00
FR4340:Gbp2b	UTSW	3	142603652	missense	probably benign	0.00
FR4342:Gbp2b	UTSW	3	142603652	missense	probably benign	0.00
FR4589:Gbp2b	UTSW	3	142603652	missense	probably benign	0.00
R0329:Gbp2b	UTSW	3	142608176	missense	probably benign	0.01
R0345:Gbp2b	UTSW	3	142608183	missense	probably damaging	1.00
R0358:Gbp2b	UTSW	3	142606789	missense	probably damaging	1.00
R0732:Gbp2b	UTSW	3	142606978	missense	probably benign
R1163:Gbp2b	UTSW	3	142599096	missense	probably damaging	1.00
R1550:Gbp2b	UTSW	3	142606830	missense	probably damaging	0.99
R1629:Gbp2b	UTSW	3	142610974	missense	possibly damaging	0.93
R1886:Gbp2b	UTSW	3	142608302	missense	probably benign
R1887:Gbp2b	UTSW	3	142608302	missense	probably benign
R2188:Gbp2b	UTSW	3	142608279	missense	probably benign	0.44
R2261:Gbp2b	UTSW	3	142606735	missense	probably benign	0.00
R3977:Gbp2b	UTSW	3	142603709	missense	probably benign	0.02
R4718:Gbp2b	UTSW	3	142598995	missense	probably damaging	1.00
R4788:Gbp2b	UTSW	3	142611410	missense	probably benign	0.21
R4807:Gbp2b	UTSW	3	142598245	missense	probably benign	0.02
R5042:Gbp2b	UTSW	3	142611463	missense	probably benign	0.03
R5087:Gbp2b	UTSW	3	142598254	missense	probably damaging	1.00
R5114:Gbp2b	UTSW	3	142598185	missense	probably damaging	1.00
R5414:Gbp2b	UTSW	3	142599091	missense	probably damaging	1.00
R5567:Gbp2b	UTSW	3	142611365	missense	possibly damaging	0.75
R5625:Gbp2b	UTSW	3	142599045	missense	probably damaging	1.00
R5685:Gbp2b	UTSW	3	142608158	missense	probably benign
R6030:Gbp2b	UTSW	3	142603653	missense	probably benign	0.00
R6030:Gbp2b	UTSW	3	142603653	missense	probably benign	0.00
R6408:Gbp2b	UTSW	3	142618138	missense	probably benign	0.00
R6500:Gbp2b	UTSW	3	142611491	missense	probably benign	0.06
R6582:Gbp2b	UTSW	3	142611040	missense	possibly damaging	0.53
R6847:Gbp2b	UTSW	3	142598179	missense	probably damaging	0.96
R6923:Gbp2b	UTSW	3	142600559	missense	probably benign	0.01
R7120:Gbp2b	UTSW	3	142606746	missense	probably benign	0.01
R7255:Gbp2b	UTSW	3	142608117	missense	probably damaging	1.00
R7454:Gbp2b	UTSW	3	142598159	missense	possibly damaging	0.75
R7643:Gbp2b	UTSW	3	142603609	missense	probably benign	0.07
R8039:Gbp2b	UTSW	3	142618164	missense	probably benign	0.02
R8312:Gbp2b	UTSW	3	142599051	missense	probably benign
R8312:Gbp2b	UTSW	3	142599054	missense	probably damaging	0.96
R8391:Gbp2b	UTSW	3	142604133	missense	probably damaging	1.00
R8418:Gbp2b	UTSW	3	142603705	missense	probably benign	0.01
Z1177:Gbp2b	UTSW	3	142604316	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- AAGGACCAGTTTCTGAAGGG -3'
(R):5'- TGCACTGTAGCTTCCTTGCAG -3'

Sequencing Primer
(F):5'- ACCAGTTTCTGAAGGGGCATTAC -3'
(R):5'- CTTGCAGTCACTGACATTTGG -3'

Posted On

2018-06-22