Incidental Mutation 'R6581:Smyd5'
ID523434
Institutional Source Beutler Lab
Gene Symbol Smyd5
Ensembl Gene ENSMUSG00000033706
Gene NameSET and MYND domain containing 5
SynonymsNN8-4AG, Rai15, Rrg1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6581 (G1)
Quality Score108.008
Status Not validated
Chromosome6
Chromosomal Location85431989-85446435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 85432023 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 7 (D7N)
Ref Sequence ENSEMBL: ENSMUSP00000048537 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045693] [ENSMUST00000089578]
Predicted Effect probably damaging
Transcript: ENSMUST00000045693
AA Change: D7N

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000048537
Gene: ENSMUSG00000033706
AA Change: D7N

DomainStartEndE-ValueType
SET 21 357 8.15e-14 SMART
low complexity region 392 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089578
SMART Domains Protein: ENSMUSP00000087006
Gene: ENSMUSG00000068302

DomainStartEndE-ValueType
HOX 149 211 4.04e-22 SMART
low complexity region 213 225 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152218
Predicted Effect probably benign
Transcript: ENSMUST00000174469
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204615
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh8a1 G A 10: 21,380,842 V51M probably damaging Het
Armc4 C T 18: 7,129,560 V873I possibly damaging Het
Cdh17 A T 4: 11,799,615 I471F probably damaging Het
Dnajb7 T A 15: 81,408,025 E37V probably damaging Het
Dpy19l1 T A 9: 24,447,864 I337F possibly damaging Het
Etv5 C T 16: 22,439,699 probably benign Het
Gbp2b T A 3: 142,608,238 Y426* probably null Het
Gm21103 A T 14: 6,303,815 N78K probably damaging Het
Helz2 A G 2: 181,229,379 V2755A probably damaging Het
Itga9 A T 9: 118,658,564 E238D probably benign Het
Itgb8 A T 12: 119,163,215 C736S probably benign Het
Luzp1 A G 4: 136,540,631 E55G probably damaging Het
Mkl1 A G 15: 81,016,373 L589P probably damaging Het
Ms4a4d G A 19: 11,554,840 V117M probably damaging Het
Olfr411 A G 11: 74,347,206 F126S probably damaging Het
Olfr453 T C 6: 42,744,079 L14P probably damaging Het
Olfr69 T C 7: 103,768,221 I59V probably benign Het
Prl7a1 A T 13: 27,633,629 D217E probably damaging Het
Slc12a5 T C 2: 164,987,115 F525S probably damaging Het
Spata18 G T 5: 73,669,516 R152L probably benign Het
Thbd A G 2: 148,406,272 S559P probably benign Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Tnpo2 C A 8: 85,055,404 P874Q probably damaging Het
Uchl4 A T 9: 64,235,793 E185D possibly damaging Het
Vmn1r158 G A 7: 22,790,040 T248I possibly damaging Het
Vmn1r5 T C 6: 56,985,381 F14L probably benign Het
Yaf2 T C 15: 93,286,414 T101A probably benign Het
Other mutations in Smyd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03065:Smyd5 APN 6 85442164 missense possibly damaging 0.75
IGL03261:Smyd5 APN 6 85432018 missense probably benign 0.05
R0383:Smyd5 UTSW 6 85440173 nonsense probably null
R1957:Smyd5 UTSW 6 85438139 missense probably benign 0.01
R1988:Smyd5 UTSW 6 85438136 missense possibly damaging 0.93
R2049:Smyd5 UTSW 6 85444318 missense probably benign 0.01
R3499:Smyd5 UTSW 6 85438190 missense probably damaging 1.00
R3552:Smyd5 UTSW 6 85442211 missense probably damaging 0.99
R5092:Smyd5 UTSW 6 85445203 unclassified probably benign
R6114:Smyd5 UTSW 6 85440262 intron probably benign
R7191:Smyd5 UTSW 6 85440111 missense probably benign 0.10
R7868:Smyd5 UTSW 6 85444315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAGTCAGGCCAGGTTCCAC -3'
(R):5'- TAATCTGGCCCAGGATATCCCTC -3'

Sequencing Primer
(F):5'- GGCCAGGTTCCACCCAATC -3'
(R):5'- ATATCGCCACGAGCCTGG -3'
Posted On2018-06-22