Incidental Mutation 'R6581:Uchl4'
ID523439
Institutional Source Beutler Lab
Gene Symbol Uchl4
Ensembl Gene ENSMUSG00000035337
Gene Nameubiquitin carboxyl-terminal esterase L4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6581 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location64235201-64236362 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64235793 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 185 (E185D)
Ref Sequence ENSEMBL: ENSMUSP00000045208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005066] [ENSMUST00000039011]
Predicted Effect probably benign
Transcript: ENSMUST00000005066
SMART Domains Protein: ENSMUSP00000005066
Gene: ENSMUSG00000004936

DomainStartEndE-ValueType
low complexity region 30 51 N/A INTRINSIC
S_TKc 68 361 4.44e-80 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000039011
AA Change: E185D

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000045208
Gene: ENSMUSG00000035337
AA Change: E185D

DomainStartEndE-ValueType
Pfam:Peptidase_C12 6 217 2.2e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214497
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh8a1 G A 10: 21,380,842 V51M probably damaging Het
Armc4 C T 18: 7,129,560 V873I possibly damaging Het
Cdh17 A T 4: 11,799,615 I471F probably damaging Het
Dnajb7 T A 15: 81,408,025 E37V probably damaging Het
Dpy19l1 T A 9: 24,447,864 I337F possibly damaging Het
Etv5 C T 16: 22,439,699 probably benign Het
Gbp2b T A 3: 142,608,238 Y426* probably null Het
Gm21103 A T 14: 6,303,815 N78K probably damaging Het
Helz2 A G 2: 181,229,379 V2755A probably damaging Het
Itga9 A T 9: 118,658,564 E238D probably benign Het
Itgb8 A T 12: 119,163,215 C736S probably benign Het
Luzp1 A G 4: 136,540,631 E55G probably damaging Het
Mkl1 A G 15: 81,016,373 L589P probably damaging Het
Ms4a4d G A 19: 11,554,840 V117M probably damaging Het
Olfr411 A G 11: 74,347,206 F126S probably damaging Het
Olfr453 T C 6: 42,744,079 L14P probably damaging Het
Olfr69 T C 7: 103,768,221 I59V probably benign Het
Prl7a1 A T 13: 27,633,629 D217E probably damaging Het
Slc12a5 T C 2: 164,987,115 F525S probably damaging Het
Smyd5 G A 6: 85,432,023 D7N probably damaging Het
Spata18 G T 5: 73,669,516 R152L probably benign Het
Thbd A G 2: 148,406,272 S559P probably benign Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Tnpo2 C A 8: 85,055,404 P874Q probably damaging Het
Vmn1r158 G A 7: 22,790,040 T248I possibly damaging Het
Vmn1r5 T C 6: 56,985,381 F14L probably benign Het
Yaf2 T C 15: 93,286,414 T101A probably benign Het
Other mutations in Uchl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01468:Uchl4 APN 9 64235716 missense possibly damaging 0.82
IGL01710:Uchl4 APN 9 64235506 missense probably benign 0.20
IGL02030:Uchl4 APN 9 64235629 missense probably benign
IGL02739:Uchl4 APN 9 64235537 missense probably damaging 1.00
R0026:Uchl4 UTSW 9 64235371 splice site probably null
R0026:Uchl4 UTSW 9 64235371 splice site probably null
R1572:Uchl4 UTSW 9 64235731 missense probably benign
R1801:Uchl4 UTSW 9 64235475 missense probably benign
R2113:Uchl4 UTSW 9 64235536 missense probably damaging 1.00
R4042:Uchl4 UTSW 9 64235557 missense probably benign 0.00
R4500:Uchl4 UTSW 9 64235881 missense possibly damaging 0.96
R4625:Uchl4 UTSW 9 64235798 missense probably damaging 1.00
R5176:Uchl4 UTSW 9 64235740 nonsense probably null
R5364:Uchl4 UTSW 9 64235539 missense possibly damaging 0.88
R7134:Uchl4 UTSW 9 64235339 missense probably damaging 1.00
R7451:Uchl4 UTSW 9 64235731 missense probably benign
R8268:Uchl4 UTSW 9 64235509 missense probably damaging 1.00
R8804:Uchl4 UTSW 9 64235324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGTCTGTATCAATGAGCCC -3'
(R):5'- TTCAGGAAAGACCGGGCTTC -3'

Sequencing Primer
(F):5'- GTCTGTATCAATGAGCCCTGAAG -3'
(R):5'- TCTAGAACTTGGAGAGCCACCTG -3'
Posted On2018-06-22