Incidental Mutation 'R6581:Prl7a1'
ID523444
Institutional Source Beutler Lab
Gene Symbol Prl7a1
Ensembl Gene ENSMUSG00000006488
Gene Nameprolactin family 7, subfamily a, member 1
SynonymsPLP-G, Prlpg, Prlpe, PLP-E
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6581 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location27633366-27642493 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27633629 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 217 (D217E)
Ref Sequence ENSEMBL: ENSMUSP00000093614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006659] [ENSMUST00000095924] [ENSMUST00000224852]
Predicted Effect probably damaging
Transcript: ENSMUST00000006659
AA Change: D216E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000006659
Gene: ENSMUSG00000006488
AA Change: D216E

DomainStartEndE-ValueType
Pfam:Hormone_1 16 82 9.9e-8 PFAM
Pfam:Hormone_1 82 256 2.6e-30 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000095924
AA Change: D217E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000093614
Gene: ENSMUSG00000006488
AA Change: D217E

DomainStartEndE-ValueType
Pfam:Hormone_1 17 257 7.8e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000224852
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh8a1 G A 10: 21,380,842 V51M probably damaging Het
Armc4 C T 18: 7,129,560 V873I possibly damaging Het
Cdh17 A T 4: 11,799,615 I471F probably damaging Het
Dnajb7 T A 15: 81,408,025 E37V probably damaging Het
Dpy19l1 T A 9: 24,447,864 I337F possibly damaging Het
Etv5 C T 16: 22,439,699 probably benign Het
Gbp2b T A 3: 142,608,238 Y426* probably null Het
Gm21103 A T 14: 6,303,815 N78K probably damaging Het
Helz2 A G 2: 181,229,379 V2755A probably damaging Het
Itga9 A T 9: 118,658,564 E238D probably benign Het
Itgb8 A T 12: 119,163,215 C736S probably benign Het
Luzp1 A G 4: 136,540,631 E55G probably damaging Het
Mkl1 A G 15: 81,016,373 L589P probably damaging Het
Ms4a4d G A 19: 11,554,840 V117M probably damaging Het
Olfr411 A G 11: 74,347,206 F126S probably damaging Het
Olfr453 T C 6: 42,744,079 L14P probably damaging Het
Olfr69 T C 7: 103,768,221 I59V probably benign Het
Slc12a5 T C 2: 164,987,115 F525S probably damaging Het
Smyd5 G A 6: 85,432,023 D7N probably damaging Het
Spata18 G T 5: 73,669,516 R152L probably benign Het
Thbd A G 2: 148,406,272 S559P probably benign Het
Tiam2 CGGG CGGGG 17: 3,414,622 probably null Het
Tnpo2 C A 8: 85,055,404 P874Q probably damaging Het
Uchl4 A T 9: 64,235,793 E185D possibly damaging Het
Vmn1r158 G A 7: 22,790,040 T248I possibly damaging Het
Vmn1r5 T C 6: 56,985,381 F14L probably benign Het
Yaf2 T C 15: 93,286,414 T101A probably benign Het
Other mutations in Prl7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00826:Prl7a1 APN 13 27640795 missense probably damaging 0.97
IGL02862:Prl7a1 APN 13 27639889 missense probably benign 0.05
R0841:Prl7a1 UTSW 13 27642410 splice site probably benign
R1005:Prl7a1 UTSW 13 27642446 missense possibly damaging 0.75
R1641:Prl7a1 UTSW 13 27633629 missense probably damaging 1.00
R1991:Prl7a1 UTSW 13 27633672 missense probably damaging 0.96
R2233:Prl7a1 UTSW 13 27642419 critical splice donor site probably null
R4061:Prl7a1 UTSW 13 27635849 missense possibly damaging 0.83
R4239:Prl7a1 UTSW 13 27637566 missense possibly damaging 0.92
R4817:Prl7a1 UTSW 13 27635764 missense probably damaging 0.99
R4976:Prl7a1 UTSW 13 27633581 missense possibly damaging 0.52
R4992:Prl7a1 UTSW 13 27635686 splice site probably null
R5119:Prl7a1 UTSW 13 27633581 missense possibly damaging 0.52
R5857:Prl7a1 UTSW 13 27640701 missense probably damaging 0.99
R6060:Prl7a1 UTSW 13 27637588 missense probably damaging 1.00
R6164:Prl7a1 UTSW 13 27637643 missense probably benign 0.00
R7126:Prl7a1 UTSW 13 27642419 critical splice donor site probably null
R7892:Prl7a1 UTSW 13 27633678 missense not run
R7908:Prl7a1 UTSW 13 27642450 start codon destroyed probably null 0.91
R8376:Prl7a1 UTSW 13 27637655 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAATCCATTTGTCAACCAAGCC -3'
(R):5'- ACATGTCTGAAAGATGTGTCAGTC -3'

Sequencing Primer
(F):5'- AAGATGCCCATTTTACTCATGC -3'
(R):5'- CAGACTGATTATCATCTTTGTCA -3'
Posted On2018-06-22