Incidental Mutation 'R6593:Traf3ip1'
ID523454
Institutional Source Beutler Lab
Gene Symbol Traf3ip1
Ensembl Gene ENSMUSG00000034292
Gene NameTRAF3 interacting protein 1
SynonymsMIP-T3, 3930402D05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6593 (G1)
Quality Score130.008
Status Validated
Chromosome1
Chromosomal Location91494647-91529307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 91527695 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 626 (K626R)
Ref Sequence ENSEMBL: ENSMUSP00000140151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047242] [ENSMUST00000189341]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047242
AA Change: K597R

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000042391
Gene: ENSMUSG00000034292
AA Change: K597R

DomainStartEndE-ValueType
Pfam:MIP-T3 49 619 7e-207 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187588
Predicted Effect possibly damaging
Transcript: ENSMUST00000189341
AA Change: K626R

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140151
Gene: ENSMUSG00000034292
AA Change: K626R

DomainStartEndE-ValueType
Pfam:MIP-T3 49 648 7.1e-203 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 96.6%
  • 20x: 89.6%
Validation Efficiency 100% (37/37)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality, cardiac edema, abnormal neural development, polydactyly, and microphthalmia associated with a lack of embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C A 5: 8,853,491 N1047K probably benign Het
AI597479 C A 1: 43,111,248 Q173K probably damaging Het
Arhgef10 T C 8: 14,962,522 L282P probably damaging Het
Arhgef10 T C 8: 14,962,564 I296T possibly damaging Het
Atg2b A G 12: 105,644,848 S1275P probably damaging Het
Ccdc114 T A 7: 45,947,384 D378E probably damaging Het
Cep290 T C 10: 100,508,776 M485T probably benign Het
Clca3a2 A G 3: 144,808,577 probably null Het
Clcn6 C T 4: 148,010,769 S731N probably benign Het
Clic6 A G 16: 92,528,117 I388V possibly damaging Het
Cpsf4l G T 11: 113,709,366 probably benign Het
Ddx58 T C 4: 40,226,651 I169V probably benign Het
Dlg5 G A 14: 24,150,652 H1350Y probably benign Het
Dnase2b T C 3: 146,586,911 Y169C probably damaging Het
Elavl3 C T 9: 22,018,547 V354M possibly damaging Het
Farp2 A C 1: 93,569,940 I231L possibly damaging Het
Gcc2 T A 10: 58,271,507 M755K probably damaging Het
Gpr88 T C 3: 116,252,624 T13A unknown Het
Gstm3 T A 3: 107,968,195 N40Y probably benign Het
Krtap5-2 A T 7: 142,174,960 C328S unknown Het
Lpar1 A T 4: 58,486,605 V222E probably damaging Het
Neto2 A G 8: 85,669,546 S192P probably damaging Het
Olfr665 C T 7: 104,881,433 T242I probably damaging Het
Pcdhgb1 G T 18: 37,682,081 D542Y probably damaging Het
Phldb2 G A 16: 45,825,427 Q264* probably null Het
Ptgs2 G A 1: 150,101,033 D6N possibly damaging Het
Rasef G T 4: 73,745,090 H167N probably damaging Het
Rbbp4 A G 4: 129,322,375 L193S probably damaging Het
Sec24d T C 3: 123,353,412 F673S probably damaging Het
Slc9b1 T C 3: 135,357,458 M1T probably null Het
Stra6 A G 9: 58,151,979 T542A probably benign Het
Stt3b T C 9: 115,252,511 Y569C probably damaging Het
Washc2 T A 6: 116,259,249 I1227N probably damaging Het
Xpo7 G A 14: 70,682,362 A671V probably damaging Het
Zfp799 A G 17: 32,819,790 Y501H probably damaging Het
Other mutations in Traf3ip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01355:Traf3ip1 APN 1 91518297 missense probably damaging 0.98
IGL01997:Traf3ip1 APN 1 91507570 critical splice donor site probably null
IGL02431:Traf3ip1 APN 1 91499635 missense unknown
IGL03106:Traf3ip1 APN 1 91522887 missense probably benign 0.26
R0538:Traf3ip1 UTSW 1 91499619 missense unknown
R1034:Traf3ip1 UTSW 1 91518319 splice site probably null
R1065:Traf3ip1 UTSW 1 91500784 missense unknown
R1757:Traf3ip1 UTSW 1 91522857 missense probably damaging 1.00
R2360:Traf3ip1 UTSW 1 91499652 missense unknown
R2367:Traf3ip1 UTSW 1 91507520 missense possibly damaging 0.90
R3031:Traf3ip1 UTSW 1 91520100 missense probably damaging 1.00
R3752:Traf3ip1 UTSW 1 91500917 splice site probably benign
R3752:Traf3ip1 UTSW 1 91518297 missense probably damaging 0.98
R4690:Traf3ip1 UTSW 1 91520112 missense possibly damaging 0.90
R4747:Traf3ip1 UTSW 1 91527757 missense probably damaging 1.00
R5328:Traf3ip1 UTSW 1 91520069 missense probably damaging 1.00
R5540:Traf3ip1 UTSW 1 91501315 missense probably benign 0.07
R5910:Traf3ip1 UTSW 1 91527745 missense probably damaging 1.00
R6836:Traf3ip1 UTSW 1 91521000 missense probably benign 0.17
R7249:Traf3ip1 UTSW 1 91527639 missense probably damaging 1.00
R7436:Traf3ip1 UTSW 1 91511388 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTACCATCCTTAGGGCTCTGAC -3'
(R):5'- AAGATCTGACCTTAGCTGGC -3'

Sequencing Primer
(F):5'- TTAGGGCTCTGACACTGAAAC -3'
(R):5'- AGGCCATTTCTCAGCAGACTG -3'
Posted On2018-06-22