Incidental Mutation 'R6593:Gstm3'
ID523457
Institutional Source Beutler Lab
Gene Symbol Gstm3
Ensembl Gene ENSMUSG00000004038
Gene Nameglutathione S-transferase, mu 3
SynonymsmGSTM5, Fsc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6593 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location107963696-107969283 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107968195 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 40 (N40Y)
Ref Sequence ENSEMBL: ENSMUSP00000004136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004136]
Predicted Effect probably benign
Transcript: ENSMUST00000004136
AA Change: N40Y

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000004136
Gene: ENSMUSG00000004038
AA Change: N40Y

DomainStartEndE-ValueType
Pfam:GST_N 3 82 6.6e-22 PFAM
Pfam:GST_C_3 41 190 7.7e-11 PFAM
Pfam:GST_C 104 191 1.6e-17 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 96.6%
  • 20x: 89.6%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C A 5: 8,853,491 N1047K probably benign Het
AI597479 C A 1: 43,111,248 Q173K probably damaging Het
Arhgef10 T C 8: 14,962,564 I296T possibly damaging Het
Arhgef10 T C 8: 14,962,522 L282P probably damaging Het
Atg2b A G 12: 105,644,848 S1275P probably damaging Het
Ccdc114 T A 7: 45,947,384 D378E probably damaging Het
Cep290 T C 10: 100,508,776 M485T probably benign Het
Clca3a2 A G 3: 144,808,577 probably null Het
Clcn6 C T 4: 148,010,769 S731N probably benign Het
Clic6 A G 16: 92,528,117 I388V possibly damaging Het
Cpsf4l G T 11: 113,709,366 probably benign Het
Ddx58 T C 4: 40,226,651 I169V probably benign Het
Dlg5 G A 14: 24,150,652 H1350Y probably benign Het
Dnase2b T C 3: 146,586,911 Y169C probably damaging Het
Elavl3 C T 9: 22,018,547 V354M possibly damaging Het
Farp2 A C 1: 93,569,940 I231L possibly damaging Het
Gcc2 T A 10: 58,271,507 M755K probably damaging Het
Gpr88 T C 3: 116,252,624 T13A unknown Het
Krtap5-2 A T 7: 142,174,960 C328S unknown Het
Lpar1 A T 4: 58,486,605 V222E probably damaging Het
Neto2 A G 8: 85,669,546 S192P probably damaging Het
Olfr665 C T 7: 104,881,433 T242I probably damaging Het
Pcdhgb1 G T 18: 37,682,081 D542Y probably damaging Het
Phldb2 G A 16: 45,825,427 Q264* probably null Het
Ptgs2 G A 1: 150,101,033 D6N possibly damaging Het
Rasef G T 4: 73,745,090 H167N probably damaging Het
Rbbp4 A G 4: 129,322,375 L193S probably damaging Het
Sec24d T C 3: 123,353,412 F673S probably damaging Het
Slc9b1 T C 3: 135,357,458 M1T probably null Het
Stra6 A G 9: 58,151,979 T542A probably benign Het
Stt3b T C 9: 115,252,511 Y569C probably damaging Het
Traf3ip1 A G 1: 91,527,695 K626R possibly damaging Het
Washc2 T A 6: 116,259,249 I1227N probably damaging Het
Xpo7 G A 14: 70,682,362 A671V probably damaging Het
Zfp799 A G 17: 32,819,790 Y501H probably damaging Het
Other mutations in Gstm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01585:Gstm3 APN 3 107966158 missense probably benign 0.42
IGL01637:Gstm3 APN 3 107967633 missense probably damaging 1.00
IGL01937:Gstm3 APN 3 107967657 missense probably damaging 0.98
IGL01945:Gstm3 APN 3 107967657 missense probably damaging 0.98
IGL02307:Gstm3 APN 3 107967613 missense probably damaging 0.98
IGL02820:Gstm3 APN 3 107968758 splice site probably benign
IGL03038:Gstm3 APN 3 107966169 missense possibly damaging 0.75
IGL03108:Gstm3 APN 3 107967764 critical splice donor site probably null
IGL03271:Gstm3 APN 3 107966197 missense possibly damaging 0.47
IGL03097:Gstm3 UTSW 3 107968801 missense probably benign
R0009:Gstm3 UTSW 3 107967840 missense probably damaging 1.00
R0883:Gstm3 UTSW 3 107966270 splice site probably benign
R1623:Gstm3 UTSW 3 107967835 missense possibly damaging 0.80
R2108:Gstm3 UTSW 3 107966134 missense probably damaging 0.99
R3005:Gstm3 UTSW 3 107967607 missense probably benign 0.03
R3802:Gstm3 UTSW 3 107964235 missense probably benign 0.03
R3803:Gstm3 UTSW 3 107964235 missense probably benign 0.03
R3804:Gstm3 UTSW 3 107964235 missense probably benign 0.03
R4604:Gstm3 UTSW 3 107968197 missense possibly damaging 0.73
R4837:Gstm3 UTSW 3 107964215 missense probably benign
R6963:Gstm3 UTSW 3 107967624 missense probably benign 0.01
R7790:Gstm3 UTSW 3 107969239 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AACACTGTGCAGCCAACAGG -3'
(R):5'- TAATGAGACTGGAGTTCCGGG -3'

Sequencing Primer
(F):5'- GCCAACAGGGATGGAGC -3'
(R):5'- CGGGCCCACCTGTATTTATAATTGAG -3'
Posted On2018-06-22