Incidental Mutation 'R6593:Clca3a2'
ID 523461
Institutional Source Beutler Lab
Gene Symbol Clca3a2
Ensembl Gene ENSMUSG00000028262
Gene Name chloride channel accessory 3A2
Synonyms Clca2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock # R6593 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 144796559-144819494 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 144808577 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000029929] [ENSMUST00000199029]
AlphaFold Q9EQR4
Predicted Effect probably null
Transcript: ENSMUST00000029929
SMART Domains Protein: ENSMUSP00000029929
Gene: ENSMUSG00000028262

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.5e-21 SMART
FN3 758 857 5.49e0 SMART
Predicted Effect probably null
Transcript: ENSMUST00000197013
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198543
Predicted Effect probably benign
Transcript: ENSMUST00000199029
SMART Domains Protein: ENSMUSP00000143543
Gene: ENSMUSG00000028262

DomainStartEndE-ValueType
Pfam:CLCA 1 188 6.5e-77 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 96.6%
  • 20x: 89.6%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C A 5: 8,853,491 N1047K probably benign Het
AI597479 C A 1: 43,111,248 Q173K probably damaging Het
Arhgef10 T C 8: 14,962,522 L282P probably damaging Het
Arhgef10 T C 8: 14,962,564 I296T possibly damaging Het
Atg2b A G 12: 105,644,848 S1275P probably damaging Het
Ccdc114 T A 7: 45,947,384 D378E probably damaging Het
Cep290 T C 10: 100,508,776 M485T probably benign Het
Clcn6 C T 4: 148,010,769 S731N probably benign Het
Clic6 A G 16: 92,528,117 I388V possibly damaging Het
Cpsf4l G T 11: 113,709,366 probably benign Het
Ddx58 T C 4: 40,226,651 I169V probably benign Het
Dlg5 G A 14: 24,150,652 H1350Y probably benign Het
Dnase2b T C 3: 146,586,911 Y169C probably damaging Het
Elavl3 C T 9: 22,018,547 V354M possibly damaging Het
Farp2 A C 1: 93,569,940 I231L possibly damaging Het
Gcc2 T A 10: 58,271,507 M755K probably damaging Het
Gpr88 T C 3: 116,252,624 T13A unknown Het
Gstm3 T A 3: 107,968,195 N40Y probably benign Het
Krtap5-2 A T 7: 142,174,960 C328S unknown Het
Lpar1 A T 4: 58,486,605 V222E probably damaging Het
Neto2 A G 8: 85,669,546 S192P probably damaging Het
Olfr665 C T 7: 104,881,433 T242I probably damaging Het
Pcdhgb1 G T 18: 37,682,081 D542Y probably damaging Het
Phldb2 G A 16: 45,825,427 Q264* probably null Het
Ptgs2 G A 1: 150,101,033 D6N possibly damaging Het
Rasef G T 4: 73,745,090 H167N probably damaging Het
Rbbp4 A G 4: 129,322,375 L193S probably damaging Het
Sec24d T C 3: 123,353,412 F673S probably damaging Het
Slc9b1 T C 3: 135,357,458 M1T probably null Het
Stra6 A G 9: 58,151,979 T542A probably benign Het
Stt3b T C 9: 115,252,511 Y569C probably damaging Het
Traf3ip1 A G 1: 91,527,695 K626R possibly damaging Het
Washc2 T A 6: 116,259,249 I1227N probably damaging Het
Xpo7 G A 14: 70,682,362 A671V probably damaging Het
Zfp799 A G 17: 32,819,790 Y501H probably damaging Het
Other mutations in Clca3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Clca3a2 APN 3 144813627 nonsense probably null
IGL01663:Clca3a2 APN 3 144817155 missense probably damaging 0.97
IGL01779:Clca3a2 APN 3 144819378 missense possibly damaging 0.47
IGL02066:Clca3a2 APN 3 144813455 missense probably benign
IGL02301:Clca3a2 APN 3 144806372 missense probably damaging 0.98
IGL02619:Clca3a2 APN 3 144806322 missense probably damaging 1.00
IGL02852:Clca3a2 APN 3 144806343 missense probably damaging 0.98
IGL02901:Clca3a2 APN 3 144816768 missense probably damaging 1.00
IGL03162:Clca3a2 APN 3 144806416 missense probably damaging 1.00
R0032:Clca3a2 UTSW 3 144816733 missense probably benign 0.01
R0244:Clca3a2 UTSW 3 144813898 missense possibly damaging 0.90
R1249:Clca3a2 UTSW 3 144803004 missense possibly damaging 0.80
R1370:Clca3a2 UTSW 3 144813863 splice site probably benign
R1586:Clca3a2 UTSW 3 144810716 missense possibly damaging 0.94
R1776:Clca3a2 UTSW 3 144813920 missense probably damaging 1.00
R1797:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1869:Clca3a2 UTSW 3 144806403 missense probably benign 0.44
R1871:Clca3a2 UTSW 3 144797637 missense probably benign 0.01
R1919:Clca3a2 UTSW 3 144810696 missense probably benign
R1923:Clca3a2 UTSW 3 144805730 missense probably damaging 1.00
R2200:Clca3a2 UTSW 3 144813924 missense probably benign 0.10
R2324:Clca3a2 UTSW 3 144806280 critical splice donor site probably null
R2937:Clca3a2 UTSW 3 144813918 missense probably benign 0.06
R3429:Clca3a2 UTSW 3 144806327 missense probably benign 0.07
R3434:Clca3a2 UTSW 3 144808761 unclassified probably benign
R3551:Clca3a2 UTSW 3 144803081 missense probably damaging 1.00
R3952:Clca3a2 UTSW 3 144803061 missense probably damaging 1.00
R4120:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4383:Clca3a2 UTSW 3 144806320 missense probably benign 0.02
R4518:Clca3a2 UTSW 3 144808705 missense probably damaging 1.00
R4598:Clca3a2 UTSW 3 144805683 missense probably damaging 1.00
R4801:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4802:Clca3a2 UTSW 3 144807351 missense possibly damaging 0.95
R4816:Clca3a2 UTSW 3 144810852 missense probably benign 0.25
R4934:Clca3a2 UTSW 3 144817931 missense probably damaging 1.00
R4942:Clca3a2 UTSW 3 144806502 missense probably damaging 1.00
R5123:Clca3a2 UTSW 3 144806343 missense probably damaging 1.00
R5156:Clca3a2 UTSW 3 144805838 missense probably benign 0.26
R5275:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R5372:Clca3a2 UTSW 3 144797525 missense probably benign 0.00
R5656:Clca3a2 UTSW 3 144797632 missense probably benign 0.26
R6059:Clca3a2 UTSW 3 144810770 missense probably damaging 1.00
R6155:Clca3a2 UTSW 3 144819357 missense probably damaging 0.99
R6254:Clca3a2 UTSW 3 144802134 missense probably benign
R6336:Clca3a2 UTSW 3 144806478 missense probably benign
R6470:Clca3a2 UTSW 3 144804263 splice site probably null
R6631:Clca3a2 UTSW 3 144813644 missense probably benign
R6826:Clca3a2 UTSW 3 144818054 missense possibly damaging 0.46
R6836:Clca3a2 UTSW 3 144806383 missense probably damaging 0.97
R6896:Clca3a2 UTSW 3 144808701 missense probably damaging 1.00
R7211:Clca3a2 UTSW 3 144814014 missense probably benign 0.00
R7324:Clca3a2 UTSW 3 144808611 missense probably damaging 0.99
R7411:Clca3a2 UTSW 3 144802099 missense probably damaging 1.00
R7486:Clca3a2 UTSW 3 144797601 missense probably damaging 1.00
R7491:Clca3a2 UTSW 3 144813579 missense probably damaging 1.00
R7521:Clca3a2 UTSW 3 144801913 makesense probably null
R7889:Clca3a2 UTSW 3 144810813 nonsense probably null
R7946:Clca3a2 UTSW 3 144807314 critical splice donor site probably null
R7991:Clca3a2 UTSW 3 144813995 missense probably benign 0.00
R8022:Clca3a2 UTSW 3 144805766 missense probably damaging 1.00
R8344:Clca3a2 UTSW 3 144805942 critical splice acceptor site probably null
R8367:Clca3a2 UTSW 3 144817747 splice site probably null
R8371:Clca3a2 UTSW 3 144807353 nonsense probably null
R8814:Clca3a2 UTSW 3 144797764 missense probably benign 0.18
R9031:Clca3a2 UTSW 3 144805714 missense probably damaging 1.00
R9201:Clca3a2 UTSW 3 144813923 missense probably benign 0.00
R9261:Clca3a2 UTSW 3 144819397 missense probably benign
R9469:Clca3a2 UTSW 3 144802177 missense probably damaging 1.00
R9515:Clca3a2 UTSW 3 144803047 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTATTTGCGTAACCATGGAGAC -3'
(R):5'- TCCAGTGACCAGAGCACTTC -3'

Sequencing Primer
(F):5'- CAGAGCATCTGTTTAGTGCAATG -3'
(R):5'- AGAGCACTTCCGGTTCTGAGATC -3'
Posted On 2018-06-22