Incidental Mutation 'R6593:Olfr665'
ID523471
Institutional Source Beutler Lab
Gene Symbol Olfr665
Ensembl Gene ENSMUSG00000073917
Gene Nameolfactory receptor 665
SynonymsGA_x6K02T2PBJ9-7509539-7510489, MOR34-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6593 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104878031-104882906 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 104881433 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 242 (T242I)
Ref Sequence ENSEMBL: ENSMUSP00000150229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098165] [ENSMUST00000215761] [ENSMUST00000216257] [ENSMUST00000216971]
Predicted Effect probably damaging
Transcript: ENSMUST00000098165
AA Change: T242I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095768
Gene: ENSMUSG00000073917
AA Change: T242I

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 6.4e-105 PFAM
Pfam:7TM_GPCR_Srsx 37 310 1e-5 PFAM
Pfam:7tm_1 43 295 1.4e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215761
AA Change: T242I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216257
AA Change: T242I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216971
AA Change: T242I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 96.6%
  • 20x: 89.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C A 5: 8,853,491 N1047K probably benign Het
AI597479 C A 1: 43,111,248 Q173K probably damaging Het
Arhgef10 T C 8: 14,962,522 L282P probably damaging Het
Arhgef10 T C 8: 14,962,564 I296T possibly damaging Het
Atg2b A G 12: 105,644,848 S1275P probably damaging Het
Ccdc114 T A 7: 45,947,384 D378E probably damaging Het
Cep290 T C 10: 100,508,776 M485T probably benign Het
Clca3a2 A G 3: 144,808,577 probably null Het
Clcn6 C T 4: 148,010,769 S731N probably benign Het
Clic6 A G 16: 92,528,117 I388V possibly damaging Het
Cpsf4l G T 11: 113,709,366 probably benign Het
Ddx58 T C 4: 40,226,651 I169V probably benign Het
Dlg5 G A 14: 24,150,652 H1350Y probably benign Het
Dnase2b T C 3: 146,586,911 Y169C probably damaging Het
Elavl3 C T 9: 22,018,547 V354M possibly damaging Het
Farp2 A C 1: 93,569,940 I231L possibly damaging Het
Gcc2 T A 10: 58,271,507 M755K probably damaging Het
Gpr88 T C 3: 116,252,624 T13A unknown Het
Gstm3 T A 3: 107,968,195 N40Y probably benign Het
Krtap5-2 A T 7: 142,174,960 C328S unknown Het
Lpar1 A T 4: 58,486,605 V222E probably damaging Het
Neto2 A G 8: 85,669,546 S192P probably damaging Het
Pcdhgb1 G T 18: 37,682,081 D542Y probably damaging Het
Phldb2 G A 16: 45,825,427 Q264* probably null Het
Ptgs2 G A 1: 150,101,033 D6N possibly damaging Het
Rasef G T 4: 73,745,090 H167N probably damaging Het
Rbbp4 A G 4: 129,322,375 L193S probably damaging Het
Sec24d T C 3: 123,353,412 F673S probably damaging Het
Slc9b1 T C 3: 135,357,458 M1T probably null Het
Stra6 A G 9: 58,151,979 T542A probably benign Het
Stt3b T C 9: 115,252,511 Y569C probably damaging Het
Traf3ip1 A G 1: 91,527,695 K626R possibly damaging Het
Washc2 T A 6: 116,259,249 I1227N probably damaging Het
Xpo7 G A 14: 70,682,362 A671V probably damaging Het
Zfp799 A G 17: 32,819,790 Y501H probably damaging Het
Other mutations in Olfr665
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Olfr665 APN 7 104881517 missense probably benign 0.01
IGL01408:Olfr665 APN 7 104880830 missense probably benign 0.02
IGL02022:Olfr665 APN 7 104880934 missense probably damaging 1.00
R0349:Olfr665 UTSW 7 104880992 missense possibly damaging 0.48
R0585:Olfr665 UTSW 7 104881499 missense probably damaging 1.00
R1518:Olfr665 UTSW 7 104881308 nonsense probably null
R1659:Olfr665 UTSW 7 104881180 missense probably benign 0.00
R1727:Olfr665 UTSW 7 104881514 missense probably benign 0.11
R1762:Olfr665 UTSW 7 104881240 missense probably damaging 0.99
R4052:Olfr665 UTSW 7 104881603 missense probably damaging 0.99
R4208:Olfr665 UTSW 7 104881603 missense probably damaging 0.99
R5486:Olfr665 UTSW 7 104880961 missense probably benign 0.02
R5513:Olfr665 UTSW 7 104881499 missense probably damaging 1.00
R6148:Olfr665 UTSW 7 104881082 missense possibly damaging 0.84
R7143:Olfr665 UTSW 7 104881186 missense probably damaging 1.00
R7189:Olfr665 UTSW 7 104881141 nonsense probably null
R7413:Olfr665 UTSW 7 104880850 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- GCGTCTTCCATACTGTAGAGG -3'
(R):5'- ACCTTCACGAATCTGCTTGG -3'

Sequencing Primer
(F):5'- GTCTTCCATACTGTAGAGGAAACC -3'
(R):5'- CACGAATCTGCTTGGTCTTTAC -3'
Posted On2018-06-22