Incidental Mutation 'R6593:Elavl3'
ID523476
Institutional Source Beutler Lab
Gene Symbol Elavl3
Ensembl Gene ENSMUSG00000003410
Gene NameELAV like RNA binding protein 3
Synonyms2600009P04Rik, Huc, mHuC
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.335) question?
Stock #R6593 (G1)
Quality Score136.008
Status Validated
Chromosome9
Chromosomal Location22015005-22052023 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 22018547 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 354 (V354M)
Ref Sequence ENSEMBL: ENSMUSP00000003501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003493] [ENSMUST00000003501] [ENSMUST00000115331] [ENSMUST00000215901] [ENSMUST00000216344]
PDB Structure
SOLUTION STRUCTURE OF THE FIRST RNA-BINDING DOMAIN (RBD1) OF HU ANTIGEN C (HUC) [SOLUTION NMR]
SOLUTION STRUCTURE OF THE SECOND RNA-BINDING DOMAIN (RBD2) OF HU ANTIGEN C (HUC) [SOLUTION NMR]
SOLUTION STRUCTURE OF THE HUC RBD1-RBD2 COMPLEXED WITH THE AU-RICH ELEMENT [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000003493
SMART Domains Protein: ENSMUSP00000003493
Gene: ENSMUSG00000003402

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
LDLa 32 72 3.01e-2 SMART
internal_repeat_1 91 105 3.48e-7 PROSPERO
low complexity region 177 191 N/A INTRINSIC
Pfam:EF-hand_5 214 236 5.5e-5 PFAM
Pfam:EF-hand_5 239 257 4.4e-4 PFAM
low complexity region 290 341 N/A INTRINSIC
Pfam:PRKCSH_1 366 512 4.3e-23 PFAM
Pfam:PRKCSH 406 464 1.1e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000003501
AA Change: V354M

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000003501
Gene: ENSMUSG00000003410
AA Change: V354M

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
RRM 40 113 9.99e-24 SMART
RRM 126 201 2.81e-18 SMART
low complexity region 266 283 N/A INTRINSIC
RRM 285 358 1.79e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115331
SMART Domains Protein: ENSMUSP00000110987
Gene: ENSMUSG00000003402

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
LDLa 32 72 3.01e-2 SMART
internal_repeat_1 91 105 1.7e-7 PROSPERO
low complexity region 177 191 N/A INTRINSIC
Pfam:EF-hand_5 215 236 3.2e-5 PFAM
Pfam:EF-hand_5 239 257 1.2e-3 PFAM
low complexity region 290 352 N/A INTRINSIC
Pfam:PRKCSH_1 373 519 4.4e-23 PFAM
Pfam:PRKCSH 413 471 4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213700
Predicted Effect probably benign
Transcript: ENSMUST00000215901
Predicted Effect probably benign
Transcript: ENSMUST00000216344
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.2%
  • 10x: 96.6%
  • 20x: 89.6%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A member of the ELAVL protein family, ELAV-like 3 is a neural-specific RNA-binding protein which contains three RNP-type RNA recognition motifs. The observation that ELAVL3 is one of several Hu antigens (neuronal-specific RNA-binding proteins) recognized by the anti-Hu serum antibody present in sera from patients with paraneoplastic encephalomyelitis and sensory neuronopathy (PEM/PSN) suggests it has a role in neurogenesis. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit strain-specific preweaning lethality, abnormal cortical hypersynchronization and non-convulsive electropgraphic seizure. Mice heterozygous for the allele exhibit abnormal brain wave pattern and spike wave discharge. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1b C A 5: 8,853,491 N1047K probably benign Het
AI597479 C A 1: 43,111,248 Q173K probably damaging Het
Arhgef10 T C 8: 14,962,522 L282P probably damaging Het
Arhgef10 T C 8: 14,962,564 I296T possibly damaging Het
Atg2b A G 12: 105,644,848 S1275P probably damaging Het
Ccdc114 T A 7: 45,947,384 D378E probably damaging Het
Cep290 T C 10: 100,508,776 M485T probably benign Het
Clca3a2 A G 3: 144,808,577 probably null Het
Clcn6 C T 4: 148,010,769 S731N probably benign Het
Clic6 A G 16: 92,528,117 I388V possibly damaging Het
Cpsf4l G T 11: 113,709,366 probably benign Het
Ddx58 T C 4: 40,226,651 I169V probably benign Het
Dlg5 G A 14: 24,150,652 H1350Y probably benign Het
Dnase2b T C 3: 146,586,911 Y169C probably damaging Het
Farp2 A C 1: 93,569,940 I231L possibly damaging Het
Gcc2 T A 10: 58,271,507 M755K probably damaging Het
Gpr88 T C 3: 116,252,624 T13A unknown Het
Gstm3 T A 3: 107,968,195 N40Y probably benign Het
Krtap5-2 A T 7: 142,174,960 C328S unknown Het
Lpar1 A T 4: 58,486,605 V222E probably damaging Het
Neto2 A G 8: 85,669,546 S192P probably damaging Het
Olfr665 C T 7: 104,881,433 T242I probably damaging Het
Pcdhgb1 G T 18: 37,682,081 D542Y probably damaging Het
Phldb2 G A 16: 45,825,427 Q264* probably null Het
Ptgs2 G A 1: 150,101,033 D6N possibly damaging Het
Rasef G T 4: 73,745,090 H167N probably damaging Het
Rbbp4 A G 4: 129,322,375 L193S probably damaging Het
Sec24d T C 3: 123,353,412 F673S probably damaging Het
Slc9b1 T C 3: 135,357,458 M1T probably null Het
Stra6 A G 9: 58,151,979 T542A probably benign Het
Stt3b T C 9: 115,252,511 Y569C probably damaging Het
Traf3ip1 A G 1: 91,527,695 K626R possibly damaging Het
Washc2 T A 6: 116,259,249 I1227N probably damaging Het
Xpo7 G A 14: 70,682,362 A671V probably damaging Het
Zfp799 A G 17: 32,819,790 Y501H probably damaging Het
Other mutations in Elavl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:Elavl3 APN 9 22036718 missense probably damaging 1.00
IGL02740:Elavl3 APN 9 22036379 missense probably benign 0.06
IGL03011:Elavl3 APN 9 22036316 missense probably damaging 1.00
IGL03211:Elavl3 APN 9 22018678 missense probably damaging 1.00
R0022:Elavl3 UTSW 9 22036871 splice site probably benign
R0105:Elavl3 UTSW 9 22036833 missense possibly damaging 0.84
R0850:Elavl3 UTSW 9 22036763 missense probably damaging 0.96
R1496:Elavl3 UTSW 9 22026165 splice site probably benign
R1499:Elavl3 UTSW 9 22018579 missense probably damaging 0.97
R3500:Elavl3 UTSW 9 22018744 missense probably damaging 1.00
R3714:Elavl3 UTSW 9 22018599 missense probably benign 0.11
R3715:Elavl3 UTSW 9 22018599 missense probably benign 0.11
R3937:Elavl3 UTSW 9 22018744 missense probably damaging 1.00
R3938:Elavl3 UTSW 9 22018744 missense probably damaging 1.00
R4791:Elavl3 UTSW 9 22024678 missense probably damaging 0.99
R4856:Elavl3 UTSW 9 22026318 missense possibly damaging 0.64
R4886:Elavl3 UTSW 9 22026318 missense possibly damaging 0.64
R4962:Elavl3 UTSW 9 22036811 missense probably benign 0.06
R5526:Elavl3 UTSW 9 22036326 missense probably benign
R5643:Elavl3 UTSW 9 22018733 missense probably benign 0.12
R7102:Elavl3 UTSW 9 22018729 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- ACCCTGTGGTGTTTATGCAG -3'
(R):5'- GGTGCATCTTCGTGTACAACC -3'

Sequencing Primer
(F):5'- CAGGTGTATGGGTCTGCC -3'
(R):5'- TGTCCCCAGAAGCTGATGAG -3'
Posted On2018-06-22