Mutagenetix > Incidental Mutation

Incidental Mutation 'R6576:Vmn2r23'

523499

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r23

Ensembl Gene

ENSMUSG00000091620

Gene Name

vomeronasal 2, receptor 23

Synonyms

EG435916

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.062) question?

Stock #

R6576 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123702821-123742291 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 123733273 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 512 (T512A)

Ref Sequence

ENSEMBL: ENSMUSP00000126682 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172391]

AlphaFold

E9PXI5

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158091

Predicted Effect

probably benign
Transcript: ENSMUST00000172391
AA Change: T512A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000126682
Gene: ENSMUSG00000091620
AA Change: T512A

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:ANF_receptor	79	461	1.7e-31	PFAM
Pfam:NCD3G	513	566	1.2e-23	PFAM
Pfam:7tm_3	596	834	1.5e-55	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

92% (34/37)

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933430I17Rik	A	T	4: 62,532,605	T102S	possibly damaging	Het
Aff4	C	A	11: 53,400,441	H743N	probably damaging	Het
Apba3	A	G	10: 81,273,091	T563A	probably benign	Het
Arhgap20	T	C	9: 51,849,278	S774P	probably benign	Het
Asap2	A	G	12: 21,244,703	Y528C	probably damaging	Het
Cep162	A	G	9: 87,217,145	S767P	probably benign	Het
Ces1b	T	A	8: 93,056,919	T558S	probably benign	Het
Chd8	T	C	14: 52,216,076	Y1176C	probably damaging	Het
Cldn15	A	T	5: 136,974,616	E157D	probably damaging	Het
Col4a3	T	A	1: 82,708,574		probably null	Het
Cpsf1	CCCCTGCATGAGGCAGGTCCC	CCCC	15: 76,597,455		probably null	Het
Dnaaf3	A	G	7: 4,523,380	I566T	probably benign	Het
Drc7	A	T	8: 95,075,258	I716F	probably damaging	Het
Epp13	G	A	7: 6,277,542		probably benign	Het
Fam35a	T	C	14: 34,268,242	T236A	probably damaging	Het
Fat3	G	A	9: 16,377,210	T339I	probably damaging	Het
Fat4	T	C	3: 38,979,690	I2497T	probably benign	Het
Fmo6	A	G	1: 162,922,695	F264S	probably damaging	Het
Gtf2i	T	C	5: 134,263,702	D356G	probably damaging	Het
Id1	T	C	2: 152,736,663	V108A	probably benign	Het
Kcnq3	T	C	15: 66,025,178	D291G	possibly damaging	Het
Klc3	G	T	7: 19,397,980	D157E	possibly damaging	Het
Lasp1	C	T	11: 97,833,576	R94C	probably damaging	Het
Lmbr1	A	T	5: 29,291,310	M93K	probably damaging	Het
Lrrc75a	G	A	11: 62,605,869	P289L	probably damaging	Het
Med11	G	T	11: 70,453,170	K105N	probably benign	Het
Mrgprx2	A	T	7: 48,482,632	I146N	probably damaging	Het
Mrpl20	A	G	4: 155,806,914	I69V	probably benign	Het
Pik3c3	A	G	18: 30,342,741		probably benign	Het
Rad54b	T	A	4: 11,601,577	N377K	probably benign	Het
Rilp	A	G	11: 75,512,392		probably null	Het
Ripk2	A	T	4: 16,131,558		probably null	Het
Rnf167	A	C	11: 70,649,762	K156T	possibly damaging	Het
Snx29	T	C	16: 11,715,056		probably null	Het
Sox6	T	A	7: 115,701,702	I177F	probably damaging	Het
Tln1	A	T	4: 43,555,419		probably null	Het
Unc13a	T	A	8: 71,653,478	T661S	probably benign	Het
Vmn2r87	G	A	10: 130,478,785	L311F	probably benign	Het
Wdr64	G	T	1: 175,805,928	S915I	possibly damaging	Het
Xpo5	T	A	17: 46,240,808		probably null	Het
Zswim8	T	C	14: 20,721,874	V1548A	probably benign	Het

Other mutations in Vmn2r23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Vmn2r23	APN	6	123729725	missense	possibly damaging	0.89
IGL01012:Vmn2r23	APN	6	123729596	missense	probably benign
IGL01073:Vmn2r23	APN	6	123712800	missense	possibly damaging	0.82
IGL01547:Vmn2r23	APN	6	123704424	missense	possibly damaging	0.88
IGL01571:Vmn2r23	APN	6	123704407	missense	probably damaging	1.00
IGL01950:Vmn2r23	APN	6	123741886	missense	possibly damaging	0.80
IGL02028:Vmn2r23	APN	6	123741860	missense	probably damaging	1.00
IGL02248:Vmn2r23	APN	6	123741744	missense	probably damaging	0.96
IGL02318:Vmn2r23	APN	6	123741836	missense	probably benign	0.10
IGL02649:Vmn2r23	APN	6	123704478	missense	probably benign
IGL02831:Vmn2r23	APN	6	123704385	missense	probably benign	0.22
IGL02832:Vmn2r23	APN	6	123704396	missense	probably benign	0.00
IGL02865:Vmn2r23	APN	6	123741619	missense	probably damaging	1.00
IGL02964:Vmn2r23	APN	6	123741782	missense	possibly damaging	0.93
IGL03347:Vmn2r23	APN	6	123704374	missense	probably benign	0.01
IGL03396:Vmn2r23	APN	6	123729626	missense	probably damaging	1.00
PIT4472001:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R0597:Vmn2r23	UTSW	6	123729721	missense	probably benign	0.08
R0677:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R0904:Vmn2r23	UTSW	6	123742135	missense	probably damaging	1.00
R1330:Vmn2r23	UTSW	6	123742004	missense	probably damaging	1.00
R1424:Vmn2r23	UTSW	6	123713270	nonsense	probably null
R1629:Vmn2r23	UTSW	6	123713427	missense	probably benign	0.05
R1842:Vmn2r23	UTSW	6	123729690	missense	possibly damaging	0.77
R1867:Vmn2r23	UTSW	6	123702915	missense	probably damaging	1.00
R1919:Vmn2r23	UTSW	6	123713010	missense	possibly damaging	0.94
R2087:Vmn2r23	UTSW	6	123741499	missense	probably benign	0.00
R2338:Vmn2r23	UTSW	6	123704425	missense	possibly damaging	0.88
R2568:Vmn2r23	UTSW	6	123742188	nonsense	probably null
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R2867:Vmn2r23	UTSW	6	123713164	missense	possibly damaging	0.94
R3500:Vmn2r23	UTSW	6	123713170	missense	possibly damaging	0.81
R3789:Vmn2r23	UTSW	6	123741389	missense	probably damaging	1.00
R4164:Vmn2r23	UTSW	6	123729738	missense	probably benign
R4506:Vmn2r23	UTSW	6	123702925	missense	probably damaging	1.00
R4652:Vmn2r23	UTSW	6	123741730	missense	probably damaging	1.00
R4697:Vmn2r23	UTSW	6	123741826	missense	probably damaging	1.00
R4840:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R4983:Vmn2r23	UTSW	6	123733349	missense	probably damaging	1.00
R5276:Vmn2r23	UTSW	6	123712977	missense	possibly damaging	0.62
R5392:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R5528:Vmn2r23	UTSW	6	123713002	missense	probably damaging	1.00
R5529:Vmn2r23	UTSW	6	123713451	missense	probably benign	0.00
R5664:Vmn2r23	UTSW	6	123713074	missense	probably damaging	1.00
R5749:Vmn2r23	UTSW	6	123733273	missense	probably benign
R5761:Vmn2r23	UTSW	6	123712759	missense	probably benign	0.39
R5762:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R5868:Vmn2r23	UTSW	6	123712942	missense	probably benign	0.12
R5935:Vmn2r23	UTSW	6	123741895	missense	possibly damaging	0.94
R6242:Vmn2r23	UTSW	6	123704400	missense	possibly damaging	0.82
R6416:Vmn2r23	UTSW	6	123712902	missense	probably damaging	1.00
R6524:Vmn2r23	UTSW	6	123713425	missense	probably damaging	1.00
R6925:Vmn2r23	UTSW	6	123704553	missense	probably damaging	1.00
R7148:Vmn2r23	UTSW	6	123713022	missense	probably benign
R7215:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R7252:Vmn2r23	UTSW	6	123741581	missense	probably damaging	0.97
R7403:Vmn2r23	UTSW	6	123704579	missense	probably benign	0.01
R8015:Vmn2r23	UTSW	6	123704541	missense	probably benign	0.00
R8143:Vmn2r23	UTSW	6	123741353	missense	probably damaging	0.99
R8474:Vmn2r23	UTSW	6	123704640	missense	probably benign	0.36
R8520:Vmn2r23	UTSW	6	123741656	missense	probably damaging	0.99
R8679:Vmn2r23	UTSW	6	123713472	missense	probably damaging	0.99
R8713:Vmn2r23	UTSW	6	123703032	missense
R8966:Vmn2r23	UTSW	6	123742120	missense	possibly damaging	0.94
R9124:Vmn2r23	UTSW	6	123742079	missense	possibly damaging	0.57
R9163:Vmn2r23	UTSW	6	123741823	missense	probably damaging	1.00
R9189:Vmn2r23	UTSW	6	123704364	missense	probably benign	0.36
R9451:Vmn2r23	UTSW	6	123733393	missense	probably damaging	1.00
R9495:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
R9514:Vmn2r23	UTSW	6	123712713	missense	probably benign	0.30
RF018:Vmn2r23	UTSW	6	123713116	missense	probably benign	0.00
T0975:Vmn2r23	UTSW	6	123713161	missense	probably benign	0.00
Z1088:Vmn2r23	UTSW	6	123742108	missense	probably damaging	0.98
Z1177:Vmn2r23	UTSW	6	123729725	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- TCTGGAGAGACTTGGGAAAGTT -3'
(R):5'- GTGGTGCATTATTTCCACATTCAGA -3'

Sequencing Primer
(F):5'- GAGACTTGGGAAAGTTAAAGATCC -3'
(R):5'- TTTCCAAAAATTCCCACATGCAG -3'

Posted On

2018-06-22