Incidental Mutation 'R6576:Epp13'
ID523501
Institutional Source Beutler Lab
Gene Symbol Epp13
Ensembl Gene ENSMUSG00000053367
Gene Nameepididymal protein 13
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R6576 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location6252710-6282066 bp(+) (GRCm38)
Type of Mutationcritical splice donor site
DNA Base Change (assembly) G to A at 6277542 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000121024] [ENSMUST00000121024] [ENSMUST00000121024]
Predicted Effect probably benign
Transcript: ENSMUST00000121024
SMART Domains Protein: ENSMUSP00000113155
Gene: ENSMUSG00000053367

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121024
SMART Domains Protein: ENSMUSP00000113155
Gene: ENSMUSG00000053367

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121024
SMART Domains Protein: ENSMUSP00000113155
Gene: ENSMUSG00000053367

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128903
Predicted Effect probably benign
Transcript: ENSMUST00000155248
Predicted Effect probably benign
Transcript: ENSMUST00000155248
Predicted Effect probably benign
Transcript: ENSMUST00000155248
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 92% (34/37)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik A T 4: 62,532,605 T102S possibly damaging Het
Aff4 C A 11: 53,400,441 H743N probably damaging Het
Apba3 A G 10: 81,273,091 T563A probably benign Het
Arhgap20 T C 9: 51,849,278 S774P probably benign Het
Asap2 A G 12: 21,244,703 Y528C probably damaging Het
Cep162 A G 9: 87,217,145 S767P probably benign Het
Ces1b T A 8: 93,056,919 T558S probably benign Het
Chd8 T C 14: 52,216,076 Y1176C probably damaging Het
Cldn15 A T 5: 136,974,616 E157D probably damaging Het
Col4a3 T A 1: 82,708,574 probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dnaaf3 A G 7: 4,523,380 I566T probably benign Het
Drc7 A T 8: 95,075,258 I716F probably damaging Het
Fam35a T C 14: 34,268,242 T236A probably damaging Het
Fat3 G A 9: 16,377,210 T339I probably damaging Het
Fat4 T C 3: 38,979,690 I2497T probably benign Het
Fmo6 A G 1: 162,922,695 F264S probably damaging Het
Gtf2i T C 5: 134,263,702 D356G probably damaging Het
Id1 T C 2: 152,736,663 V108A probably benign Het
Kcnq3 T C 15: 66,025,178 D291G possibly damaging Het
Klc3 G T 7: 19,397,980 D157E possibly damaging Het
Lasp1 C T 11: 97,833,576 R94C probably damaging Het
Lmbr1 A T 5: 29,291,310 M93K probably damaging Het
Lrrc75a G A 11: 62,605,869 P289L probably damaging Het
Med11 G T 11: 70,453,170 K105N probably benign Het
Mrgprx2 A T 7: 48,482,632 I146N probably damaging Het
Mrpl20 A G 4: 155,806,914 I69V probably benign Het
Pik3c3 A G 18: 30,342,741 probably benign Het
Rad54b T A 4: 11,601,577 N377K probably benign Het
Rilp A G 11: 75,512,392 probably null Het
Ripk2 A T 4: 16,131,558 probably null Het
Rnf167 A C 11: 70,649,762 K156T possibly damaging Het
Snx29 T C 16: 11,715,056 probably null Het
Sox6 T A 7: 115,701,702 I177F probably damaging Het
Tln1 A T 4: 43,555,419 probably null Het
Unc13a T A 8: 71,653,478 T661S probably benign Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r87 G A 10: 130,478,785 L311F probably benign Het
Wdr64 G T 1: 175,805,928 S915I possibly damaging Het
Xpo5 T A 17: 46,240,808 probably null Het
Zswim8 T C 14: 20,721,874 V1548A probably benign Het
Other mutations in Epp13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02347:Epp13 APN 7 6269884 missense possibly damaging 0.83
IGL02869:Epp13 APN 7 6269899 splice site probably benign
R1069:Epp13 UTSW 7 6255922 critical splice acceptor site probably null
R1771:Epp13 UTSW 7 6277542 critical splice donor site probably null
R4663:Epp13 UTSW 7 6258625 missense possibly damaging 0.49
R4790:Epp13 UTSW 7 6266318 nonsense probably null
R5011:Epp13 UTSW 7 6266333 intron probably benign
R5013:Epp13 UTSW 7 6266333 intron probably benign
R5388:Epp13 UTSW 7 6266347 critical splice donor site probably null
R7224:Epp13 UTSW 7 6268802 missense probably benign 0.09
R7665:Epp13 UTSW 7 6269892 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCTAGGGGCGCAAGTTTGG -3'
(R):5'- TCTACTTGATTGTGCACAGACAC -3'

Sequencing Primer
(F):5'- GGCGCAAGTTTGGAGTACC -3'
(R):5'- ACACACATGAGTATACTCTCGGGTG -3'
Posted On2018-06-22