Mutagenetix > Incidental Mutations

Incidental Mutation 'R6576:Sox6'

523504

Institutional Source

Beutler Lab

Gene Symbol

Sox6

Ensembl Gene

ENSMUSG00000051910

Gene Name

SRY (sex determining region Y)-box 6

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6576 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

115470872-116038796 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 115701702 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 177 (I177F)

Ref Sequence

ENSEMBL: ENSMUSP00000102223 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072804] [ENSMUST00000106612] [ENSMUST00000166207] [ENSMUST00000166877] [ENSMUST00000169129] [ENSMUST00000205405] [ENSMUST00000206034] [ENSMUST00000206369]

AlphaFold

P40645

Predicted Effect

possibly damaging
Transcript: ENSMUST00000072804
AA Change: I177F

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000072583
Gene: ENSMUSG00000051910
AA Change: I177F

Domain	Start	End	E-Value	Type
coiled coil region	184	261	N/A	INTRINSIC
low complexity region	462	484	N/A	INTRINSIC
low complexity region	507	517	N/A	INTRINSIC
HMG	619	689	1.5e-25	SMART
low complexity region	797	809	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106612
AA Change: I177F

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000102223
Gene: ENSMUSG00000051910
AA Change: I177F

Domain	Start	End	E-Value	Type
coiled coil region	184	261	N/A	INTRINSIC
low complexity region	323	333	N/A	INTRINSIC
low complexity region	420	442	N/A	INTRINSIC
low complexity region	465	475	N/A	INTRINSIC
HMG	577	647	1.5e-25	SMART
low complexity region	755	767	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166207
AA Change: I177F

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000129027
Gene: ENSMUSG00000051910
AA Change: I177F

Domain	Start	End	E-Value	Type
coiled coil region	184	261	N/A	INTRINSIC
low complexity region	462	484	N/A	INTRINSIC
low complexity region	507	517	N/A	INTRINSIC
HMG	619	689	1.5e-25	SMART
low complexity region	797	809	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166877
AA Change: I177F

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000129512
Gene: ENSMUSG00000051910
AA Change: I177F

Domain	Start	End	E-Value	Type
coiled coil region	184	263	N/A	INTRINSIC
low complexity region	324	335	N/A	INTRINSIC
low complexity region	422	444	N/A	INTRINSIC
low complexity region	467	477	N/A	INTRINSIC
HMG	579	649	1.5e-25	SMART
low complexity region	757	769	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169129
AA Change: I177F

PolyPhen 2 Score 0.208 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000126404
Gene: ENSMUSG00000051910
AA Change: I177F

Domain	Start	End	E-Value	Type
coiled coil region	184	263	N/A	INTRINSIC
low complexity region	324	335	N/A	INTRINSIC
low complexity region	422	444	N/A	INTRINSIC
low complexity region	467	477	N/A	INTRINSIC
HMG	579	649	1.5e-25	SMART
low complexity region	757	769	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000205405
AA Change: I177F

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205980

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206034
AA Change: I177F

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206369
AA Change: I177F

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206573

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

92% (34/37)

MGI Phenotype

FUNCTION: This gene encodes a member of a family of transcriptional regulators containing high mobility group (HMG) DNA-binding domains. Function of the encoded protein is important for proper cardiac and skeletal development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for null mutations exhibit cardioskeletal myopathy, cardiac blockage, delayed growth, and early postnatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933430I17Rik	A	T	4: 62,532,605	T102S	possibly damaging	Het
Aff4	C	A	11: 53,400,441	H743N	probably damaging	Het
Apba3	A	G	10: 81,273,091	T563A	probably benign	Het
Arhgap20	T	C	9: 51,849,278	S774P	probably benign	Het
Asap2	A	G	12: 21,244,703	Y528C	probably damaging	Het
Cep162	A	G	9: 87,217,145	S767P	probably benign	Het
Ces1b	T	A	8: 93,056,919	T558S	probably benign	Het
Chd8	T	C	14: 52,216,076	Y1176C	probably damaging	Het
Cldn15	A	T	5: 136,974,616	E157D	probably damaging	Het
Col4a3	T	A	1: 82,708,574		probably null	Het
Cpsf1	CCCCTGCATGAGGCAGGTCCC	CCCC	15: 76,597,455		probably null	Het
Dnaaf3	A	G	7: 4,523,380	I566T	probably benign	Het
Drc7	A	T	8: 95,075,258	I716F	probably damaging	Het
Epp13	G	A	7: 6,277,542		probably benign	Het
Fam35a	T	C	14: 34,268,242	T236A	probably damaging	Het
Fat3	G	A	9: 16,377,210	T339I	probably damaging	Het
Fat4	T	C	3: 38,979,690	I2497T	probably benign	Het
Fmo6	A	G	1: 162,922,695	F264S	probably damaging	Het
Gtf2i	T	C	5: 134,263,702	D356G	probably damaging	Het
Id1	T	C	2: 152,736,663	V108A	probably benign	Het
Kcnq3	T	C	15: 66,025,178	D291G	possibly damaging	Het
Klc3	G	T	7: 19,397,980	D157E	possibly damaging	Het
Lasp1	C	T	11: 97,833,576	R94C	probably damaging	Het
Lmbr1	A	T	5: 29,291,310	M93K	probably damaging	Het
Lrrc75a	G	A	11: 62,605,869	P289L	probably damaging	Het
Med11	G	T	11: 70,453,170	K105N	probably benign	Het
Mrgprx2	A	T	7: 48,482,632	I146N	probably damaging	Het
Mrpl20	A	G	4: 155,806,914	I69V	probably benign	Het
Pik3c3	A	G	18: 30,342,741		probably benign	Het
Rad54b	T	A	4: 11,601,577	N377K	probably benign	Het
Rilp	A	G	11: 75,512,392		probably null	Het
Ripk2	A	T	4: 16,131,558		probably null	Het
Rnf167	A	C	11: 70,649,762	K156T	possibly damaging	Het
Snx29	T	C	16: 11,715,056		probably null	Het
Tln1	A	T	4: 43,555,419		probably null	Het
Unc13a	T	A	8: 71,653,478	T661S	probably benign	Het
Vmn2r23	A	G	6: 123,733,273	T512A	probably benign	Het
Vmn2r87	G	A	10: 130,478,785	L311F	probably benign	Het
Wdr64	G	T	1: 175,805,928	S915I	possibly damaging	Het
Xpo5	T	A	17: 46,240,808		probably null	Het
Zswim8	T	C	14: 20,721,874	V1548A	probably benign	Het

Other mutations in Sox6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00518:Sox6	APN	7	115477206	missense	probably benign
IGL00957:Sox6	APN	7	115777092	missense	probably damaging	1.00
IGL01624:Sox6	APN	7	115476968	missense	probably damaging	1.00
IGL02057:Sox6	APN	7	115550075	missense	probably damaging	1.00
IGL02385:Sox6	APN	7	115550039	missense	possibly damaging	0.77
IGL02410:Sox6	APN	7	115486744	missense	probably damaging	1.00
IGL02736:Sox6	APN	7	115580640	missense	probably damaging	1.00
IGL02747:Sox6	APN	7	115489746	missense	probably damaging	1.00
IGL02792:Sox6	APN	7	115541649	missense	probably benign
PIT4480001:Sox6	UTSW	7	115597509	missense	probably benign	0.03
R0458:Sox6	UTSW	7	115489794	missense	probably damaging	1.00
R0689:Sox6	UTSW	7	115486551	missense	probably damaging	1.00
R0800:Sox6	UTSW	7	115579014	critical splice donor site	probably null
R1220:Sox6	UTSW	7	115662442	missense	probably damaging	1.00
R1474:Sox6	UTSW	7	115701691	splice site	probably benign
R1547:Sox6	UTSW	7	115701722	missense	possibly damaging	0.93
R1570:Sox6	UTSW	7	115777123	missense	probably damaging	1.00
R1674:Sox6	UTSW	7	115801419	missense	probably benign	0.00
R1704:Sox6	UTSW	7	115476948	missense	possibly damaging	0.92
R1754:Sox6	UTSW	7	115477055	missense	probably benign
R1833:Sox6	UTSW	7	115777093	missense	probably damaging	1.00
R1868:Sox6	UTSW	7	115659538	missense	possibly damaging	0.89
R1893:Sox6	UTSW	7	115544568	missense	probably benign	0.28
R2386:Sox6	UTSW	7	115597505	missense	probably damaging	1.00
R2431:Sox6	UTSW	7	115550007	splice site	probably null
R4303:Sox6	UTSW	7	115544469	critical splice donor site	probably null
R4319:Sox6	UTSW	7	115580563	critical splice donor site	probably null
R4320:Sox6	UTSW	7	115580563	critical splice donor site	probably null
R4321:Sox6	UTSW	7	115580563	critical splice donor site	probably null
R4323:Sox6	UTSW	7	115580563	critical splice donor site	probably null
R4335:Sox6	UTSW	7	115512724	missense	probably benign
R4567:Sox6	UTSW	7	115662322	missense	probably benign	0.26
R4776:Sox6	UTSW	7	115541670	missense	probably damaging	1.00
R4838:Sox6	UTSW	7	115486662	missense	probably damaging	1.00
R4914:Sox6	UTSW	7	115476964	missense	probably damaging	1.00
R4915:Sox6	UTSW	7	115476964	missense	probably damaging	1.00
R5184:Sox6	UTSW	7	115777228	missense	probably damaging	1.00
R5372:Sox6	UTSW	7	115550151	nonsense	probably null
R5454:Sox6	UTSW	7	115701773	missense	possibly damaging	0.89
R5663:Sox6	UTSW	7	115550054	missense	probably benign
R5685:Sox6	UTSW	7	115579157	splice site	probably null
R5734:Sox6	UTSW	7	115541621	critical splice donor site	probably null
R6020:Sox6	UTSW	7	115486628	missense	probably damaging	1.00
R6211:Sox6	UTSW	7	115801462	missense	probably damaging	1.00
R6263:Sox6	UTSW	7	115477060	missense	probably damaging	1.00
R6549:Sox6	UTSW	7	115486692	missense	possibly damaging	0.79
R6680:Sox6	UTSW	7	115476983	missense	possibly damaging	0.94
R6709:Sox6	UTSW	7	115701789	splice site	probably null
R6747:Sox6	UTSW	7	115541731	missense	probably damaging	1.00
R6755:Sox6	UTSW	7	115662442	missense	probably damaging	0.99
R7233:Sox6	UTSW	7	115489809	missense	possibly damaging	0.80
R7423:Sox6	UTSW	7	115550023	missense	probably benign	0.30
R7455:Sox6	UTSW	7	115489669	missense	probably benign	0.02
R7522:Sox6	UTSW	7	115801578	missense	probably damaging	1.00
R7527:Sox6	UTSW	7	115777173	missense	probably benign	0.00
R7852:Sox6	UTSW	7	115801604	start codon destroyed	probably null	1.00
R7936:Sox6	UTSW	7	115544595	missense	probably benign
R8278:Sox6	UTSW	7	115476964	missense	probably damaging	1.00
R8335:Sox6	UTSW	7	115701714	missense	probably damaging	1.00
R8558:Sox6	UTSW	7	115541798	missense	probably benign	0.12
R8682:Sox6	UTSW	7	115476956	missense	probably damaging	1.00
R8693:Sox6	UTSW	7	115662397	missense	probably damaging	0.99
R8712:Sox6	UTSW	7	115597508	missense	probably benign	0.00
R8972:Sox6	UTSW	7	115476983	nonsense	probably null
R9297:Sox6	UTSW	7	115662322	missense	probably benign	0.26
R9318:Sox6	UTSW	7	115662322	missense	probably benign	0.26
X0061:Sox6	UTSW	7	115477148	missense	probably benign	0.00
X0065:Sox6	UTSW	7	115550108	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTAGTTTGTACACTGACACTGGGG -3'
(R):5'- GTTTCCCAAGGAGCCAGTTG -3'

Sequencing Primer
(F):5'- CACTTTACAGAGAAGACATTCAGG -3'
(R):5'- GCTCAGGCAGCTCACCCTC -3'

Posted On

2018-06-22