Incidental Mutation 'R6576:Unc13a'
ID523505
Institutional Source Beutler Lab
Gene Symbol Unc13a
Ensembl Gene ENSMUSG00000034799
Gene Nameunc-13 homolog A (C. elegans)
Synonyms2410078G03Rik, Munc13-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6576 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location71624417-71671757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71653478 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 661 (T661S)
Ref Sequence ENSEMBL: ENSMUSP00000135189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030170] [ENSMUST00000177517]
Predicted Effect probably benign
Transcript: ENSMUST00000030170
AA Change: T661S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030170
Gene: ENSMUSG00000034799
AA Change: T661S

DomainStartEndE-ValueType
C2 3 94 5.23e-10 SMART
low complexity region 187 202 N/A INTRINSIC
low complexity region 264 277 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
coiled coil region 321 359 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 435 450 N/A INTRINSIC
PDB:2KDU|B 454 488 3e-16 PDB
C1 563 612 3.93e-18 SMART
C2 686 793 5.86e-22 SMART
DUF1041 1002 1111 1.6e-56 SMART
Pfam:Membr_traf_MHD 1355 1520 6.3e-53 PFAM
C2 1555 1661 5.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176426
Predicted Effect probably benign
Transcript: ENSMUST00000177517
AA Change: T661S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135189
Gene: ENSMUSG00000034799
AA Change: T661S

DomainStartEndE-ValueType
C2 3 94 5.23e-10 SMART
low complexity region 187 202 N/A INTRINSIC
low complexity region 264 277 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
coiled coil region 321 359 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 435 450 N/A INTRINSIC
PDB:2KDU|B 454 488 3e-16 PDB
C1 563 612 3.93e-18 SMART
C2 686 793 5.86e-22 SMART
DUF1041 1002 1111 1.6e-56 SMART
Pfam:Membr_traf_MHD 1355 1520 6.7e-53 PFAM
C2 1574 1680 5.03e-12 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 92% (34/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UNC13 family. UNC13 proteins bind to phorbol esters and diacylglycerol and play important roles in neurotransmitter release at synapses. Single nucleotide polymorphisms in this gene may be associated with sporadic amyotrophic lateral sclerosis. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutant mice do not feed and die within hours of birth and synaptic vesicle maturation is impaired. Mice homozygous for a knock-in allele exhibit slower rate of synaptic vesicle replenishment, aberrant short-term depression and reduced recoveryfrom synaptic depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik A T 4: 62,532,605 T102S possibly damaging Het
Aff4 C A 11: 53,400,441 H743N probably damaging Het
Apba3 A G 10: 81,273,091 T563A probably benign Het
Arhgap20 T C 9: 51,849,278 S774P probably benign Het
Asap2 A G 12: 21,244,703 Y528C probably damaging Het
Cep162 A G 9: 87,217,145 S767P probably benign Het
Ces1b T A 8: 93,056,919 T558S probably benign Het
Chd8 T C 14: 52,216,076 Y1176C probably damaging Het
Cldn15 A T 5: 136,974,616 E157D probably damaging Het
Col4a3 T A 1: 82,708,574 probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dnaaf3 A G 7: 4,523,380 I566T probably benign Het
Drc7 A T 8: 95,075,258 I716F probably damaging Het
Epp13 G A 7: 6,277,542 probably benign Het
Fam35a T C 14: 34,268,242 T236A probably damaging Het
Fat3 G A 9: 16,377,210 T339I probably damaging Het
Fat4 T C 3: 38,979,690 I2497T probably benign Het
Fmo6 A G 1: 162,922,695 F264S probably damaging Het
Gtf2i T C 5: 134,263,702 D356G probably damaging Het
Id1 T C 2: 152,736,663 V108A probably benign Het
Kcnq3 T C 15: 66,025,178 D291G possibly damaging Het
Klc3 G T 7: 19,397,980 D157E possibly damaging Het
Lasp1 C T 11: 97,833,576 R94C probably damaging Het
Lmbr1 A T 5: 29,291,310 M93K probably damaging Het
Lrrc75a G A 11: 62,605,869 P289L probably damaging Het
Med11 G T 11: 70,453,170 K105N probably benign Het
Mrgprx2 A T 7: 48,482,632 I146N probably damaging Het
Mrpl20 A G 4: 155,806,914 I69V probably benign Het
Pik3c3 A G 18: 30,342,741 probably benign Het
Rad54b T A 4: 11,601,577 N377K probably benign Het
Rilp A G 11: 75,512,392 probably null Het
Ripk2 A T 4: 16,131,558 probably null Het
Rnf167 A C 11: 70,649,762 K156T possibly damaging Het
Snx29 T C 16: 11,715,056 probably null Het
Sox6 T A 7: 115,701,702 I177F probably damaging Het
Tln1 A T 4: 43,555,419 probably null Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r87 G A 10: 130,478,785 L311F probably benign Het
Wdr64 G T 1: 175,805,928 S915I possibly damaging Het
Xpo5 T A 17: 46,240,808 probably null Het
Zswim8 T C 14: 20,721,874 V1548A probably benign Het
Other mutations in Unc13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Unc13a APN 8 71643147 missense probably null 0.70
IGL01023:Unc13a APN 8 71661825 missense probably benign 0.02
IGL01456:Unc13a APN 8 71644567 missense probably damaging 1.00
IGL01820:Unc13a APN 8 71654947 missense probably damaging 0.99
IGL01909:Unc13a APN 8 71639210 splice site probably benign
IGL01925:Unc13a APN 8 71634543 missense possibly damaging 0.95
IGL02407:Unc13a APN 8 71648942 missense probably damaging 0.99
IGL02622:Unc13a APN 8 71652514 splice site probably null
IGL02634:Unc13a APN 8 71655701 missense probably benign 0.03
IGL02724:Unc13a APN 8 71656305 splice site probably benign
IGL02892:Unc13a APN 8 71649910 missense probably damaging 1.00
IGL02948:Unc13a APN 8 71650549 missense possibly damaging 0.63
IGL03081:Unc13a APN 8 71649549 missense probably damaging 0.98
IGL03372:Unc13a APN 8 71655709 missense probably damaging 1.00
curvy UTSW 8 71630504 splice site probably null
Greed UTSW 8 71654845 missense probably damaging 1.00
largesse UTSW 8 71634658 missense probably damaging 1.00
serpiginous UTSW 8 71664245 missense probably damaging 1.00
PIT4469001:Unc13a UTSW 8 71658314 nonsense probably null
R0067:Unc13a UTSW 8 71634658 missense probably damaging 1.00
R0067:Unc13a UTSW 8 71634658 missense probably damaging 1.00
R0389:Unc13a UTSW 8 71658032 missense probably benign 0.01
R0457:Unc13a UTSW 8 71658001 critical splice donor site probably null
R0478:Unc13a UTSW 8 71651148 missense possibly damaging 0.92
R0483:Unc13a UTSW 8 71644913 missense probably damaging 0.96
R0609:Unc13a UTSW 8 71658467 missense probably damaging 0.96
R0611:Unc13a UTSW 8 71649865 missense probably damaging 1.00
R0730:Unc13a UTSW 8 71656285 missense possibly damaging 0.68
R0883:Unc13a UTSW 8 71642173 nonsense probably null
R1162:Unc13a UTSW 8 71647917 missense probably benign 0.31
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1196:Unc13a UTSW 8 71654986 missense probably damaging 1.00
R1400:Unc13a UTSW 8 71651221 missense probably damaging 1.00
R1446:Unc13a UTSW 8 71648981 missense possibly damaging 0.91
R1507:Unc13a UTSW 8 71658266 missense probably benign
R1636:Unc13a UTSW 8 71653390 missense probably damaging 1.00
R1858:Unc13a UTSW 8 71652399 missense probably damaging 1.00
R2025:Unc13a UTSW 8 71639768 missense possibly damaging 0.92
R2107:Unc13a UTSW 8 71656251 splice site probably null
R2286:Unc13a UTSW 8 71630559 missense probably damaging 1.00
R2334:Unc13a UTSW 8 71634558 missense probably damaging 1.00
R2924:Unc13a UTSW 8 71644952 missense possibly damaging 0.88
R3177:Unc13a UTSW 8 71629695 missense probably benign 0.01
R3277:Unc13a UTSW 8 71629695 missense probably benign 0.01
R4175:Unc13a UTSW 8 71667724 intron probably benign
R4279:Unc13a UTSW 8 71666667 missense probably damaging 0.98
R4629:Unc13a UTSW 8 71653453 missense possibly damaging 0.65
R4803:Unc13a UTSW 8 71662850 splice site probably null
R4877:Unc13a UTSW 8 71658616 missense possibly damaging 0.85
R4927:Unc13a UTSW 8 71654845 missense probably damaging 1.00
R4930:Unc13a UTSW 8 71630504 splice site probably null
R4994:Unc13a UTSW 8 71643172 missense probably benign 0.28
R5011:Unc13a UTSW 8 71641477 nonsense probably null
R5252:Unc13a UTSW 8 71652564 missense probably damaging 1.00
R5356:Unc13a UTSW 8 71662514 missense probably benign 0.02
R5458:Unc13a UTSW 8 71664245 missense probably damaging 1.00
R5514:Unc13a UTSW 8 71643151 missense probably damaging 1.00
R5784:Unc13a UTSW 8 71655666 missense possibly damaging 0.61
R5853:Unc13a UTSW 8 71655129 splice site probably null
R6183:Unc13a UTSW 8 71644666 missense probably damaging 1.00
R6277:Unc13a UTSW 8 71666639 critical splice donor site probably null
R6374:Unc13a UTSW 8 71641453 missense possibly damaging 0.70
R6392:Unc13a UTSW 8 71637809 missense possibly damaging 0.83
R6515:Unc13a UTSW 8 71647940 missense probably benign 0.44
R6943:Unc13a UTSW 8 71652377 missense probably damaging 1.00
R7045:Unc13a UTSW 8 71658763 missense possibly damaging 0.95
R7062:Unc13a UTSW 8 71663237 missense probably benign 0.00
R7146:Unc13a UTSW 8 71630553 missense probably damaging 1.00
R7260:Unc13a UTSW 8 71660585 missense possibly damaging 0.71
R7443:Unc13a UTSW 8 71630959 missense probably damaging 0.98
R7545:Unc13a UTSW 8 71641509 critical splice acceptor site probably null
R7644:Unc13a UTSW 8 71634538 missense probably benign 0.13
R7780:Unc13a UTSW 8 71658335 missense probably benign 0.02
Z1088:Unc13a UTSW 8 71654803 critical splice donor site probably null
Z1177:Unc13a UTSW 8 71644872 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCACATGCATGCTAGAGGC -3'
(R):5'- CAATCCAGAGTAGCCTCAGAGG -3'

Sequencing Primer
(F):5'- TAGAGGCAGCTTCCCTGAG -3'
(R):5'- GCGCTTTGGTGACCTGC -3'
Posted On2018-06-22