Incidental Mutation 'R6576:Cep162'
ID523510
Institutional Source Beutler Lab
Gene Symbol Cep162
Ensembl Gene ENSMUSG00000056919
Gene Namecentrosomal protein 162
Synonyms4922501C03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R6576 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location87189577-87255536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87217145 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 767 (S767P)
Ref Sequence ENSEMBL: ENSMUSP00000091319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093802]
Predicted Effect probably benign
Transcript: ENSMUST00000093802
AA Change: S767P

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000091319
Gene: ENSMUSG00000056919
AA Change: S767P

DomainStartEndE-ValueType
low complexity region 198 208 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
coiled coil region 630 674 N/A INTRINSIC
coiled coil region 695 899 N/A INTRINSIC
coiled coil region 953 1124 N/A INTRINSIC
coiled coil region 1235 1386 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 92% (34/37)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik A T 4: 62,532,605 T102S possibly damaging Het
Aff4 C A 11: 53,400,441 H743N probably damaging Het
Apba3 A G 10: 81,273,091 T563A probably benign Het
Arhgap20 T C 9: 51,849,278 S774P probably benign Het
Asap2 A G 12: 21,244,703 Y528C probably damaging Het
Ces1b T A 8: 93,056,919 T558S probably benign Het
Chd8 T C 14: 52,216,076 Y1176C probably damaging Het
Cldn15 A T 5: 136,974,616 E157D probably damaging Het
Col4a3 T A 1: 82,708,574 probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dnaaf3 A G 7: 4,523,380 I566T probably benign Het
Drc7 A T 8: 95,075,258 I716F probably damaging Het
Epp13 G A 7: 6,277,542 probably benign Het
Fam35a T C 14: 34,268,242 T236A probably damaging Het
Fat3 G A 9: 16,377,210 T339I probably damaging Het
Fat4 T C 3: 38,979,690 I2497T probably benign Het
Fmo6 A G 1: 162,922,695 F264S probably damaging Het
Gtf2i T C 5: 134,263,702 D356G probably damaging Het
Id1 T C 2: 152,736,663 V108A probably benign Het
Kcnq3 T C 15: 66,025,178 D291G possibly damaging Het
Klc3 G T 7: 19,397,980 D157E possibly damaging Het
Lasp1 C T 11: 97,833,576 R94C probably damaging Het
Lmbr1 A T 5: 29,291,310 M93K probably damaging Het
Lrrc75a G A 11: 62,605,869 P289L probably damaging Het
Med11 G T 11: 70,453,170 K105N probably benign Het
Mrgprx2 A T 7: 48,482,632 I146N probably damaging Het
Mrpl20 A G 4: 155,806,914 I69V probably benign Het
Pik3c3 A G 18: 30,342,741 probably benign Het
Rad54b T A 4: 11,601,577 N377K probably benign Het
Rilp A G 11: 75,512,392 probably null Het
Ripk2 A T 4: 16,131,558 probably null Het
Rnf167 A C 11: 70,649,762 K156T possibly damaging Het
Snx29 T C 16: 11,715,056 probably null Het
Sox6 T A 7: 115,701,702 I177F probably damaging Het
Tln1 A T 4: 43,555,419 probably null Het
Unc13a T A 8: 71,653,478 T661S probably benign Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r87 G A 10: 130,478,785 L311F probably benign Het
Wdr64 G T 1: 175,805,928 S915I possibly damaging Het
Xpo5 T A 17: 46,240,808 probably null Het
Zswim8 T C 14: 20,721,874 V1548A probably benign Het
Other mutations in Cep162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Cep162 APN 9 87227167 missense probably benign 0.24
IGL00584:Cep162 APN 9 87221090 splice site probably benign
IGL01387:Cep162 APN 9 87211811 missense probably benign 0.08
IGL01862:Cep162 APN 9 87253933 missense possibly damaging 0.90
IGL02304:Cep162 APN 9 87227147 splice site probably benign
IGL02558:Cep162 APN 9 87225733 missense probably benign 0.04
IGL02558:Cep162 APN 9 87225726 missense probably benign
IGL02602:Cep162 APN 9 87246153 missense probably benign 0.19
IGL02636:Cep162 APN 9 87248379 missense possibly damaging 0.90
IGL02680:Cep162 APN 9 87246744 missense possibly damaging 0.64
IGL03195:Cep162 APN 9 87225786 missense probably benign 0.00
circus UTSW 9 87206862 missense probably damaging 1.00
moscow UTSW 9 87193697 missense probably damaging 1.00
smiley UTSW 9 87217081 nonsense probably null
PIT4378001:Cep162 UTSW 9 87217145 missense probably benign 0.01
PIT4431001:Cep162 UTSW 9 87244345 missense probably benign 0.00
PIT4434001:Cep162 UTSW 9 87193648 missense probably damaging 1.00
R0060:Cep162 UTSW 9 87237825 splice site probably benign
R0218:Cep162 UTSW 9 87211809 missense possibly damaging 0.73
R0366:Cep162 UTSW 9 87220484 missense probably damaging 0.96
R0468:Cep162 UTSW 9 87193697 missense probably damaging 1.00
R0764:Cep162 UTSW 9 87201745 missense probably damaging 1.00
R1386:Cep162 UTSW 9 87221202 missense probably benign
R1614:Cep162 UTSW 9 87212932 missense probably damaging 1.00
R1633:Cep162 UTSW 9 87203683 missense probably benign 0.23
R1831:Cep162 UTSW 9 87206932 missense probably damaging 1.00
R1847:Cep162 UTSW 9 87204080 missense probably benign 0.06
R1941:Cep162 UTSW 9 87199995 missense probably benign 0.14
R2228:Cep162 UTSW 9 87244331 missense probably benign 0.05
R2256:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2257:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2936:Cep162 UTSW 9 87227414 missense probably benign
R3005:Cep162 UTSW 9 87232060 missense probably benign 0.00
R3508:Cep162 UTSW 9 87231977 critical splice donor site probably null
R3689:Cep162 UTSW 9 87225694 nonsense probably null
R3743:Cep162 UTSW 9 87217177 splice site probably benign
R4118:Cep162 UTSW 9 87204176 missense probably benign 0.30
R4380:Cep162 UTSW 9 87200003 missense probably damaging 0.99
R4450:Cep162 UTSW 9 87225808 missense probably damaging 1.00
R4540:Cep162 UTSW 9 87212939 missense probably damaging 1.00
R4598:Cep162 UTSW 9 87203795 missense possibly damaging 0.95
R4700:Cep162 UTSW 9 87206862 missense probably damaging 1.00
R4941:Cep162 UTSW 9 87225969 intron probably benign
R5356:Cep162 UTSW 9 87206895 missense probably damaging 1.00
R5468:Cep162 UTSW 9 87227237 missense probably benign 0.00
R5579:Cep162 UTSW 9 87203671 missense probably benign 0.26
R5859:Cep162 UTSW 9 87204092 missense probably damaging 1.00
R6114:Cep162 UTSW 9 87203710 missense probably benign
R6143:Cep162 UTSW 9 87212851 critical splice donor site probably null
R6422:Cep162 UTSW 9 87232016 missense possibly damaging 0.92
R6517:Cep162 UTSW 9 87222174 missense probably damaging 0.99
R6782:Cep162 UTSW 9 87211684 missense probably benign 0.07
R6867:Cep162 UTSW 9 87217081 nonsense probably null
R7293:Cep162 UTSW 9 87203783 missense probably benign 0.01
R7355:Cep162 UTSW 9 87253955 nonsense probably null
R7391:Cep162 UTSW 9 87248494 nonsense probably null
R7426:Cep162 UTSW 9 87192766 missense probably damaging 1.00
R7593:Cep162 UTSW 9 87204197 missense probably benign 0.40
R7710:Cep162 UTSW 9 87232119 missense probably damaging 1.00
R7841:Cep162 UTSW 9 87244316 missense probably benign 0.00
R7949:Cep162 UTSW 9 87206848 missense probably benign 0.04
R8351:Cep162 UTSW 9 87192850 nonsense probably null
R8451:Cep162 UTSW 9 87192850 nonsense probably null
R8552:Cep162 UTSW 9 87244308 missense probably benign 0.34
R8755:Cep162 UTSW 9 87232011 missense probably benign 0.02
R8762:Cep162 UTSW 9 87227261 missense probably benign 0.00
X0063:Cep162 UTSW 9 87222042 critical splice donor site probably null
Z1177:Cep162 UTSW 9 87199980 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGCGTATCAAAGTCACAGGAATAC -3'
(R):5'- GTGAAAAGTACCAGCATTTCCC -3'

Sequencing Primer
(F):5'- GTCACAGGAATACCTAATACTAAT -3'
(R):5'- TGAAAAGTACCAGCATTTCCCACTAC -3'
Posted On2018-06-22