Incidental Mutation 'R6576:Aff4'
ID523513
Institutional Source Beutler Lab
Gene Symbol Aff4
Ensembl Gene ENSMUSG00000049470
Gene NameAF4/FMR2 family, member 4
SynonymsLaf4l, Alf4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6576 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location53350833-53421830 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 53400441 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 743 (H743N)
Ref Sequence ENSEMBL: ENSMUSP00000051479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060945]
Predicted Effect probably damaging
Transcript: ENSMUST00000060945
AA Change: H743N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000051479
Gene: ENSMUSG00000049470
AA Change: H743N

DomainStartEndE-ValueType
Pfam:AF-4 2 1156 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130152
Predicted Effect probably benign
Transcript: ENSMUST00000152616
SMART Domains Protein: ENSMUSP00000118866
Gene: ENSMUSG00000049470

DomainStartEndE-ValueType
Pfam:AF-4 1 51 4e-15 PFAM
Pfam:AF-4 46 159 1.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154499
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 92% (34/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the AF4 family of transcription factors involved in leukemia. It is a component of the positive transcription elongation factor b (P-TEFb) complex. A chromosomal translocation involving this gene and MLL gene on chromosome 11 is found in infant acute lymphoblastic leukemia with ins(5;11)(q31;q31q23). [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display embryonic and neonatal lethality with incomplete penetrance, abnormal respiration, and shrunken alveoli. Surviving males are infertile with azoospermia and arrest of spermatogenesis but, do not develop hematological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik A T 4: 62,532,605 T102S possibly damaging Het
Apba3 A G 10: 81,273,091 T563A probably benign Het
Arhgap20 T C 9: 51,849,278 S774P probably benign Het
Asap2 A G 12: 21,244,703 Y528C probably damaging Het
Cep162 A G 9: 87,217,145 S767P probably benign Het
Ces1b T A 8: 93,056,919 T558S probably benign Het
Chd8 T C 14: 52,216,076 Y1176C probably damaging Het
Cldn15 A T 5: 136,974,616 E157D probably damaging Het
Col4a3 T A 1: 82,708,574 probably null Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Dnaaf3 A G 7: 4,523,380 I566T probably benign Het
Drc7 A T 8: 95,075,258 I716F probably damaging Het
Epp13 G A 7: 6,277,542 probably benign Het
Fam35a T C 14: 34,268,242 T236A probably damaging Het
Fat3 G A 9: 16,377,210 T339I probably damaging Het
Fat4 T C 3: 38,979,690 I2497T probably benign Het
Fmo6 A G 1: 162,922,695 F264S probably damaging Het
Gtf2i T C 5: 134,263,702 D356G probably damaging Het
Id1 T C 2: 152,736,663 V108A probably benign Het
Kcnq3 T C 15: 66,025,178 D291G possibly damaging Het
Klc3 G T 7: 19,397,980 D157E possibly damaging Het
Lasp1 C T 11: 97,833,576 R94C probably damaging Het
Lmbr1 A T 5: 29,291,310 M93K probably damaging Het
Lrrc75a G A 11: 62,605,869 P289L probably damaging Het
Med11 G T 11: 70,453,170 K105N probably benign Het
Mrgprx2 A T 7: 48,482,632 I146N probably damaging Het
Mrpl20 A G 4: 155,806,914 I69V probably benign Het
Pik3c3 A G 18: 30,342,741 probably benign Het
Rad54b T A 4: 11,601,577 N377K probably benign Het
Rilp A G 11: 75,512,392 probably null Het
Ripk2 A T 4: 16,131,558 probably null Het
Rnf167 A C 11: 70,649,762 K156T possibly damaging Het
Snx29 T C 16: 11,715,056 probably null Het
Sox6 T A 7: 115,701,702 I177F probably damaging Het
Tln1 A T 4: 43,555,419 probably null Het
Unc13a T A 8: 71,653,478 T661S probably benign Het
Vmn2r23 A G 6: 123,733,273 T512A probably benign Het
Vmn2r87 G A 10: 130,478,785 L311F probably benign Het
Wdr64 G T 1: 175,805,928 S915I possibly damaging Het
Xpo5 T A 17: 46,240,808 probably null Het
Zswim8 T C 14: 20,721,874 V1548A probably benign Het
Other mutations in Aff4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00793:Aff4 APN 11 53411990 missense probably damaging 0.98
IGL01348:Aff4 APN 11 53402500 missense probably benign
IGL01446:Aff4 APN 11 53415469 missense probably damaging 0.99
IGL02151:Aff4 APN 11 53399806 missense probably benign
IGL02526:Aff4 APN 11 53406682 splice site probably benign
IGL02567:Aff4 APN 11 53372751 missense possibly damaging 0.64
IGL02633:Aff4 APN 11 53409371 splice site probably benign
IGL02707:Aff4 APN 11 53399740 missense probably benign
R0090:Aff4 UTSW 11 53392782 missense probably benign 0.01
R0128:Aff4 UTSW 11 53415466 missense probably damaging 0.99
R0243:Aff4 UTSW 11 53397858 missense possibly damaging 0.74
R0345:Aff4 UTSW 11 53372881 missense probably benign 0.00
R0347:Aff4 UTSW 11 53400088 missense probably benign 0.01
R0732:Aff4 UTSW 11 53375596 missense probably benign
R0737:Aff4 UTSW 11 53410953 nonsense probably null
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1464:Aff4 UTSW 11 53372524 missense probably damaging 0.97
R1500:Aff4 UTSW 11 53372378 missense probably benign 0.00
R1693:Aff4 UTSW 11 53396553 missense probably damaging 1.00
R1743:Aff4 UTSW 11 53368695 missense possibly damaging 0.65
R1961:Aff4 UTSW 11 53372999 missense probably damaging 1.00
R2048:Aff4 UTSW 11 53398385 missense probably benign 0.39
R2138:Aff4 UTSW 11 53372512 missense possibly damaging 0.94
R2155:Aff4 UTSW 11 53399619 missense probably damaging 1.00
R2379:Aff4 UTSW 11 53408478 splice site probably benign
R4156:Aff4 UTSW 11 53410899 intron probably benign
R5001:Aff4 UTSW 11 53404357 missense probably damaging 1.00
R5281:Aff4 UTSW 11 53372288 missense probably damaging 1.00
R5477:Aff4 UTSW 11 53408472 critical splice donor site probably null
R5677:Aff4 UTSW 11 53400275 missense possibly damaging 0.55
R5992:Aff4 UTSW 11 53373010 missense probably damaging 0.99
R6764:Aff4 UTSW 11 53399830 missense probably damaging 1.00
R6988:Aff4 UTSW 11 53398237 missense probably damaging 1.00
R7034:Aff4 UTSW 11 53408409 missense probably damaging 0.99
R7177:Aff4 UTSW 11 53406639 missense probably benign 0.10
R7426:Aff4 UTSW 11 53372875 missense probably damaging 1.00
R7755:Aff4 UTSW 11 53398379 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CAACGAATGTTCTCTCCTATGGAA -3'
(R):5'- GTCAAAATAGCAAGTATTTGGGGAT -3'

Sequencing Primer
(F):5'- TCTCTCCTATGGAAGAGAAGGAGCTC -3'
(R):5'- GGACACTTGCTATTCTTCAAGCAGG -3'
Posted On2018-06-22