Mutagenetix > Incidental Mutations

Incidental Mutation 'R6576:Chd8'

523522

Institutional Source

Beutler Lab

Gene Symbol

Chd8

Ensembl Gene

ENSMUSG00000053754

Gene Name

chromodomain helicase DNA binding protein 8

Synonyms

Duplin, 5830451P18Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6576 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

52198151-52257780 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 52216076 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1176 (Y1176C)

Ref Sequence

ENSEMBL: ENSMUSP00000142890 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089752] [ENSMUST00000149975] [ENSMUST00000200169]

AlphaFold

Q09XV5

Predicted Effect

probably damaging
Transcript: ENSMUST00000089752
AA Change: Y1176C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000087184
Gene: ENSMUSG00000053754
AA Change: Y1176C

Domain	Start	End	E-Value	Type
low complexity region	255	272	N/A	INTRINSIC
low complexity region	340	374	N/A	INTRINSIC
low complexity region	404	437	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	534	N/A	INTRINSIC
low complexity region	588	607	N/A	INTRINSIC
CHROMO	642	708	1.8e-9	SMART
CHROMO	724	782	1.55e-4	SMART
DEXDc	809	1011	4.13e-37	SMART
HELICc	1165	1249	1.01e-22	SMART
low complexity region	1335	1345	N/A	INTRINSIC
low complexity region	1422	1441	N/A	INTRINSIC
Blast:DEXDc	1460	1505	4e-16	BLAST
low complexity region	1579	1590	N/A	INTRINSIC
low complexity region	1703	1714	N/A	INTRINSIC
low complexity region	1770	1785	N/A	INTRINSIC
low complexity region	1887	1903	N/A	INTRINSIC
low complexity region	2063	2107	N/A	INTRINSIC
low complexity region	2222	2239	N/A	INTRINSIC
BRK	2312	2356	1.34e-19	SMART
BRK	2381	2421	1.94e-2	SMART
low complexity region	2452	2472	N/A	INTRINSIC
low complexity region	2494	2510	N/A	INTRINSIC
low complexity region	2514	2529	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122823

Predicted Effect

probably benign
Transcript: ENSMUST00000140603

SMART Domains

Protein: ENSMUSP00000118494
Gene: ENSMUSG00000053754

Domain	Start	End	E-Value	Type
low complexity region	6	25	N/A	INTRINSIC
Blast:DEXDc	44	167	3e-43	BLAST
low complexity region	171	182	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145404

Predicted Effect

probably benign
Transcript: ENSMUST00000149975

SMART Domains

Protein: ENSMUSP00000122995
Gene: ENSMUSG00000053754

Domain	Start	End	E-Value	Type
low complexity region	74	93	N/A	INTRINSIC
Blast:DEXDc	112	235	9e-40	BLAST
low complexity region	239	250	N/A	INTRINSIC
low complexity region	363	374	N/A	INTRINSIC
low complexity region	430	445	N/A	INTRINSIC
Blast:SANT	456	515	1e-29	BLAST
low complexity region	547	563	N/A	INTRINSIC
low complexity region	723	767	N/A	INTRINSIC
low complexity region	882	899	N/A	INTRINSIC
BRK	972	1016	1.34e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155614

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180857

Predicted Effect

probably damaging
Transcript: ENSMUST00000200169
AA Change: Y1176C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142890
Gene: ENSMUSG00000053754
AA Change: Y1176C

Domain	Start	End	E-Value	Type
low complexity region	255	272	N/A	INTRINSIC
low complexity region	340	374	N/A	INTRINSIC
low complexity region	404	437	N/A	INTRINSIC
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	534	N/A	INTRINSIC
low complexity region	588	607	N/A	INTRINSIC
CHROMO	642	708	1.8e-9	SMART
CHROMO	724	782	1.55e-4	SMART
DEXDc	809	1011	4.13e-37	SMART
HELICc	1165	1249	1.01e-22	SMART
low complexity region	1335	1345	N/A	INTRINSIC
low complexity region	1422	1441	N/A	INTRINSIC
Blast:DEXDc	1460	1505	4e-16	BLAST
low complexity region	1579	1590	N/A	INTRINSIC
low complexity region	1703	1714	N/A	INTRINSIC
low complexity region	1770	1785	N/A	INTRINSIC
low complexity region	1887	1903	N/A	INTRINSIC
low complexity region	2063	2107	N/A	INTRINSIC
low complexity region	2222	2239	N/A	INTRINSIC
BRK	2312	2356	1.34e-19	SMART
BRK	2381	2421	1.94e-2	SMART
low complexity region	2452	2472	N/A	INTRINSIC
low complexity region	2494	2510	N/A	INTRINSIC
low complexity region	2514	2529	N/A	INTRINSIC
low complexity region	2538	2550	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227448

Meta Mutation Damage Score

0.9388

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.2%

Validation Efficiency

92% (34/37)

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain-helicase-DNA binding protein family, which is characterized by a SNF2-like domain and two chromatin organization modifier domains. The encoded protein also contains brahma and kismet domains, which is common to the subfamily of chromodomain-helicase-DNA binding proteins to which this protein belongs. In mammals, this gene has been shown to function in several processes including transcriptional regulation, epigenetic remodeling, promotion of cell proliferation, and regulation of RNA synthesis. Knockout of this gene causes early embryonic lethality due to widespread apoptosis. Heterozygous loss of function mutations result in autism spectrum disorder-like behaviors that include increased anxiety, repetitive behavior, and altered social behavior. [provided by RefSeq, Dec 2016]
PHENOTYPE: Homozygous null embryos are growth retarded starting at E5.5 and exhibit developmental arrest at E6.5. Mutants develop into an egg cylinder but do not form a primitive streak or mesoderm and exhibit increased apoptosis at E7.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933430I17Rik	A	T	4: 62,532,605	T102S	possibly damaging	Het
Aff4	C	A	11: 53,400,441	H743N	probably damaging	Het
Apba3	A	G	10: 81,273,091	T563A	probably benign	Het
Arhgap20	T	C	9: 51,849,278	S774P	probably benign	Het
Asap2	A	G	12: 21,244,703	Y528C	probably damaging	Het
Cep162	A	G	9: 87,217,145	S767P	probably benign	Het
Ces1b	T	A	8: 93,056,919	T558S	probably benign	Het
Cldn15	A	T	5: 136,974,616	E157D	probably damaging	Het
Col4a3	T	A	1: 82,708,574		probably null	Het
Cpsf1	CCCCTGCATGAGGCAGGTCCC	CCCC	15: 76,597,455		probably null	Het
Dnaaf3	A	G	7: 4,523,380	I566T	probably benign	Het
Drc7	A	T	8: 95,075,258	I716F	probably damaging	Het
Epp13	G	A	7: 6,277,542		probably benign	Het
Fam35a	T	C	14: 34,268,242	T236A	probably damaging	Het
Fat3	G	A	9: 16,377,210	T339I	probably damaging	Het
Fat4	T	C	3: 38,979,690	I2497T	probably benign	Het
Fmo6	A	G	1: 162,922,695	F264S	probably damaging	Het
Gtf2i	T	C	5: 134,263,702	D356G	probably damaging	Het
Id1	T	C	2: 152,736,663	V108A	probably benign	Het
Kcnq3	T	C	15: 66,025,178	D291G	possibly damaging	Het
Klc3	G	T	7: 19,397,980	D157E	possibly damaging	Het
Lasp1	C	T	11: 97,833,576	R94C	probably damaging	Het
Lmbr1	A	T	5: 29,291,310	M93K	probably damaging	Het
Lrrc75a	G	A	11: 62,605,869	P289L	probably damaging	Het
Med11	G	T	11: 70,453,170	K105N	probably benign	Het
Mrgprx2	A	T	7: 48,482,632	I146N	probably damaging	Het
Mrpl20	A	G	4: 155,806,914	I69V	probably benign	Het
Pik3c3	A	G	18: 30,342,741		probably benign	Het
Rad54b	T	A	4: 11,601,577	N377K	probably benign	Het
Rilp	A	G	11: 75,512,392		probably null	Het
Ripk2	A	T	4: 16,131,558		probably null	Het
Rnf167	A	C	11: 70,649,762	K156T	possibly damaging	Het
Snx29	T	C	16: 11,715,056		probably null	Het
Sox6	T	A	7: 115,701,702	I177F	probably damaging	Het
Tln1	A	T	4: 43,555,419		probably null	Het
Unc13a	T	A	8: 71,653,478	T661S	probably benign	Het
Vmn2r23	A	G	6: 123,733,273	T512A	probably benign	Het
Vmn2r87	G	A	10: 130,478,785	L311F	probably benign	Het
Wdr64	G	T	1: 175,805,928	S915I	possibly damaging	Het
Xpo5	T	A	17: 46,240,808		probably null	Het
Zswim8	T	C	14: 20,721,874	V1548A	probably benign	Het

Other mutations in Chd8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Chd8	APN	14	52226138	missense	probably damaging	0.99
IGL00694:Chd8	APN	14	52217970	missense	probably damaging	1.00
IGL01011:Chd8	APN	14	52231532	missense	possibly damaging	0.86
IGL01022:Chd8	APN	14	52236993	missense	probably benign
IGL01066:Chd8	APN	14	52217766	missense	probably damaging	1.00
IGL01083:Chd8	APN	14	52221420	missense	probably damaging	1.00
IGL01313:Chd8	APN	14	52210575	missense	probably damaging	1.00
IGL01396:Chd8	APN	14	52204587	unclassified	probably benign
IGL01476:Chd8	APN	14	52205490	missense	probably benign	0.32
IGL01731:Chd8	APN	14	52212654	missense	probably benign	0.12
IGL01895:Chd8	APN	14	52199094	missense	probably benign	0.00
IGL02090:Chd8	APN	14	52227234	critical splice donor site	probably null
IGL02344:Chd8	APN	14	52201650	missense	probably damaging	1.00
IGL02573:Chd8	APN	14	52219734	missense	possibly damaging	0.95
IGL02601:Chd8	APN	14	52214300	missense	possibly damaging	0.94
IGL02617:Chd8	APN	14	52235191	missense	probably benign	0.34
IGL02873:Chd8	APN	14	52222513	missense	probably damaging	0.99
IGL02974:Chd8	APN	14	52201701	splice site	probably null
IGL03058:Chd8	APN	14	52218273	missense	probably damaging	1.00
IGL03076:Chd8	APN	14	52226162	splice site	probably benign
IGL03239:Chd8	APN	14	52227548	missense	possibly damaging	0.92
PIT4431001:Chd8	UTSW	14	52218249	missense	probably damaging	0.98
PIT4468001:Chd8	UTSW	14	52207996	missense	probably benign
PIT4468001:Chd8	UTSW	14	52217881	missense	possibly damaging	0.95
R0006:Chd8	UTSW	14	52235293	missense	possibly damaging	0.51
R0006:Chd8	UTSW	14	52235293	missense	possibly damaging	0.51
R0022:Chd8	UTSW	14	52232855	missense	probably benign	0.00
R0115:Chd8	UTSW	14	52237206	missense	probably benign	0.00
R0131:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0131:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0132:Chd8	UTSW	14	52205326	missense	probably benign	0.15
R0419:Chd8	UTSW	14	52204060	missense	probably benign	0.24
R0440:Chd8	UTSW	14	52204826	missense	possibly damaging	0.91
R0452:Chd8	UTSW	14	52214587	missense	probably damaging	1.00
R0481:Chd8	UTSW	14	52237206	missense	probably benign	0.00
R0624:Chd8	UTSW	14	52219757	missense	possibly damaging	0.65
R0650:Chd8	UTSW	14	52202304	missense	probably benign	0.09
R0691:Chd8	UTSW	14	52213433	missense	probably damaging	0.96
R0790:Chd8	UTSW	14	52204025	missense	probably benign	0.07
R0835:Chd8	UTSW	14	52204025	missense	probably benign	0.07
R1180:Chd8	UTSW	14	52221108	missense	probably damaging	1.00
R1411:Chd8	UTSW	14	52224646	missense	probably benign
R1725:Chd8	UTSW	14	52232573	missense	probably benign	0.08
R1838:Chd8	UTSW	14	52204883	missense	probably benign	0.11
R1839:Chd8	UTSW	14	52204883	missense	probably benign	0.11
R1968:Chd8	UTSW	14	52220993	missense	probably damaging	0.98
R2020:Chd8	UTSW	14	52215241	missense	probably damaging	1.00
R2024:Chd8	UTSW	14	52231493	missense	probably benign	0.23
R2139:Chd8	UTSW	14	52236971	missense	probably benign	0.32
R2163:Chd8	UTSW	14	52198818	missense	possibly damaging	0.53
R2342:Chd8	UTSW	14	52205217	missense	probably benign	0.25
R2844:Chd8	UTSW	14	52204495	missense	possibly damaging	0.92
R3500:Chd8	UTSW	14	52205653	missense	probably benign	0.00
R3861:Chd8	UTSW	14	52237121	missense	probably benign	0.13
R4154:Chd8	UTSW	14	52207211	unclassified	probably benign
R4445:Chd8	UTSW	14	52204527	splice site	probably null
R4628:Chd8	UTSW	14	52206915	missense	probably benign	0.03
R4779:Chd8	UTSW	14	52231506	missense	probably damaging	1.00
R4783:Chd8	UTSW	14	52205368	missense	probably damaging	1.00
R4784:Chd8	UTSW	14	52205368	missense	probably damaging	1.00
R5001:Chd8	UTSW	14	52203915	missense	probably benign	0.09
R5280:Chd8	UTSW	14	52205125	missense	possibly damaging	0.68
R5331:Chd8	UTSW	14	52202114	intron	probably benign
R5348:Chd8	UTSW	14	52232698	missense	probably damaging	1.00
R5375:Chd8	UTSW	14	52204154	missense	probably damaging	1.00
R5470:Chd8	UTSW	14	52212609	missense	probably damaging	1.00
R5479:Chd8	UTSW	14	52215195	missense	probably benign	0.15
R5488:Chd8	UTSW	14	52213048	intron	probably benign
R5489:Chd8	UTSW	14	52213048	intron	probably benign
R5499:Chd8	UTSW	14	52204431	critical splice donor site	probably null
R5988:Chd8	UTSW	14	52217938	missense	probably damaging	1.00
R6046:Chd8	UTSW	14	52221071	missense	possibly damaging	0.60
R6125:Chd8	UTSW	14	52207034	missense	probably benign	0.16
R6212:Chd8	UTSW	14	52201698	missense	probably damaging	1.00
R6337:Chd8	UTSW	14	52204109	missense	probably damaging	1.00
R6394:Chd8	UTSW	14	52202585	missense	possibly damaging	0.66
R6590:Chd8	UTSW	14	52227237	missense	possibly damaging	0.60
R6690:Chd8	UTSW	14	52227237	missense	possibly damaging	0.60
R6786:Chd8	UTSW	14	52226668	missense	probably benign	0.33
R6913:Chd8	UTSW	14	52214494	missense	probably damaging	0.99
R7090:Chd8	UTSW	14	52215220	missense	probably damaging	0.99
R7107:Chd8	UTSW	14	52212672	missense	probably benign	0.07
R7138:Chd8	UTSW	14	52214498	missense	possibly damaging	0.83
R7383:Chd8	UTSW	14	52215319	missense	probably damaging	1.00
R7392:Chd8	UTSW	14	52232855	missense	probably benign
R7471:Chd8	UTSW	14	52204112	missense	probably benign
R7625:Chd8	UTSW	14	52237077	missense	probably benign	0.04
R7790:Chd8	UTSW	14	52226082	missense	probably damaging	1.00
R7862:Chd8	UTSW	14	52214277	missense	probably damaging	1.00
R7937:Chd8	UTSW	14	52227506	missense	probably benign	0.02
R8092:Chd8	UTSW	14	52217727	missense	probably damaging	1.00
R8237:Chd8	UTSW	14	52213352	missense	probably damaging	1.00
R8321:Chd8	UTSW	14	52232567	missense	probably benign	0.01
R8371:Chd8	UTSW	14	52232818	missense	probably benign
R8425:Chd8	UTSW	14	52210555	missense	probably damaging	1.00
R8674:Chd8	UTSW	14	52213006	missense	probably damaging	0.98
R8794:Chd8	UTSW	14	52204447	missense	probably damaging	0.98
R8828:Chd8	UTSW	14	52210580	frame shift	probably null
R8909:Chd8	UTSW	14	52212932	missense	possibly damaging	0.82
R9194:Chd8	UTSW	14	52202193	missense	probably benign	0.01
R9278:Chd8	UTSW	14	52235170	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CTGCAGGTCATTCTGTGGATTCC -3'
(R):5'- CGCTGTCTAGACATTCTGGAG -3'

Sequencing Primer
(F):5'- ATTCTGTGGATTCCAGTCTGAATC -3'
(R):5'- GACATTCTGGAGGATTATCTGATCC -3'

Posted On

2018-06-22