Incidental Mutation 'R6577:Api5'
ID523531
Institutional Source Beutler Lab
Gene Symbol Api5
Ensembl Gene ENSMUSG00000027193
Gene Nameapoptosis inhibitor 5
SynonymsAAC-11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.894) question?
Stock #R6577 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location94411682-94438136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 94422381 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 348 (Y348C)
Ref Sequence ENSEMBL: ENSMUSP00000028617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028617]
Predicted Effect probably benign
Transcript: ENSMUST00000028617
AA Change: Y348C

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000028617
Gene: ENSMUSG00000027193
AA Change: Y348C

DomainStartEndE-ValueType
Pfam:API5 4 504 8.9e-201 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152454
Meta Mutation Damage Score 0.7336 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an apoptosis inhibitory protein whose expression prevents apoptosis after growth factor deprivation. This protein suppresses the transcription factor E2F1-induced apoptosis and also interacts with, and negatively regulates Acinus, a nuclear factor involved in apoptotic DNA fragmentation. Its depletion enhances the cytotoxic action of the chemotherapeutic drugs. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik T C 18: 77,653,159 T285A probably benign Het
Arl14 A G 3: 69,223,072 E184G probably benign Het
Asap3 T C 4: 136,238,230 probably null Het
Atp11b T A 3: 35,839,162 V36E probably damaging Het
Atp13a4 C T 16: 29,479,841 S100N probably benign Het
C530008M17Rik A T 5: 76,866,100 probably benign Het
Cd27 T C 6: 125,236,793 T34A probably benign Het
Clec10a T C 11: 70,170,610 S274P probably benign Het
Cntnap2 C T 6: 46,170,272 T484I probably benign Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Def8 T C 8: 123,456,710 S304P probably benign Het
Dgkd G A 1: 87,940,240 V299M probably damaging Het
Ephb2 T C 4: 136,657,550 D850G probably damaging Het
Gjc1 T C 11: 102,800,304 N291S possibly damaging Het
Hc T C 2: 35,032,126 I563V probably benign Het
Hells C T 19: 38,931,465 Q20* probably null Het
Hid1 G C 11: 115,354,636 P448A possibly damaging Het
Igkv8-24 C T 6: 70,216,963 R87H possibly damaging Het
Irf6 A G 1: 193,169,354 S418G probably damaging Het
Kcnv2 T A 19: 27,324,020 C424S possibly damaging Het
Lmln T A 16: 33,107,000 probably null Het
Myo1a A T 10: 127,715,320 I678F possibly damaging Het
Nup98 A C 7: 102,128,846 probably null Het
Papolg GGACTTGGGATACTTACGCTTTG GG 11: 23,879,857 probably benign Het
Ppfibp1 T A 6: 146,999,655 probably null Het
Sardh T C 2: 27,218,855 T623A possibly damaging Het
Scml4 A G 10: 42,947,111 N251D probably damaging Het
Skap1 T C 11: 96,526,044 Y52H probably damaging Het
Srp68 G A 11: 116,265,464 R113W probably damaging Het
Srsf12 T C 4: 33,209,196 probably benign Het
Stat5b A G 11: 100,797,700 M312T probably benign Het
Tma7 T C 9: 109,082,194 probably benign Het
Tmem120b T G 5: 123,116,647 F304V probably damaging Het
Tns3 G A 11: 8,549,057 L9F probably damaging Het
Tns3 G T 11: 8,549,058 D8E probably damaging Het
Tsc2 C T 17: 24,610,499 A765T probably damaging Het
Uba1y A G Y: 825,465 I276V probably benign Homo
Upb1 T G 10: 75,412,889 L81R probably damaging Het
Uros C A 7: 133,700,840 C73F probably damaging Het
Zcchc6 C T 13: 59,808,161 C45Y probably damaging Het
Zfp820 T C 17: 21,819,403 I315V probably benign Het
Other mutations in Api5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01876:Api5 APN 2 94418954 splice site probably benign
IGL02203:Api5 APN 2 94425074 missense probably benign 0.00
IGL02346:Api5 APN 2 94427530 missense possibly damaging 0.77
IGL02605:Api5 APN 2 94429719 missense possibly damaging 0.88
IGL02646:Api5 APN 2 94429839 missense possibly damaging 0.62
R0018:Api5 UTSW 2 94420984 critical splice donor site probably null
R0149:Api5 UTSW 2 94423497 nonsense probably null
R0361:Api5 UTSW 2 94423497 nonsense probably null
R1554:Api5 UTSW 2 94425643 missense probably benign 0.14
R2507:Api5 UTSW 2 94429817 missense probably damaging 1.00
R3723:Api5 UTSW 2 94425613 missense possibly damaging 0.76
R3724:Api5 UTSW 2 94425613 missense possibly damaging 0.76
R3737:Api5 UTSW 2 94425613 missense possibly damaging 0.76
R3738:Api5 UTSW 2 94425613 missense possibly damaging 0.76
R4035:Api5 UTSW 2 94425613 missense possibly damaging 0.76
R4724:Api5 UTSW 2 94423471 missense possibly damaging 0.95
R5306:Api5 UTSW 2 94423466 nonsense probably null
R5337:Api5 UTSW 2 94425688 missense possibly damaging 0.94
R7031:Api5 UTSW 2 94425616 missense probably benign 0.01
R7936:Api5 UTSW 2 94438047 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ACGTGGCTTTTGGATTCTCATC -3'
(R):5'- AGGTCCTAGCTCAATTTCTAGTCTG -3'

Sequencing Primer
(F):5'- TAAGGAAGAGTGGGAAGAATCAGATC -3'
(R):5'- GTGTTCTGTGTCTTAAAATCATGC -3'
Posted On2018-06-22