Incidental Mutation 'R6577:Arl14'
ID523533
Institutional Source Beutler Lab
Gene Symbol Arl14
Ensembl Gene ENSMUSG00000098207
Gene NameADP-ribosylation factor-like 14
Synonyms9130014L17Rik, Arf7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R6577 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location69222419-69223618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69223072 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 184 (E184G)
Ref Sequence ENSEMBL: ENSMUSP00000138370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000183126]
Predicted Effect probably benign
Transcript: ENSMUST00000183126
AA Change: E184G

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000138370
Gene: ENSMUSG00000098207
AA Change: E184G

DomainStartEndE-ValueType
ARF 1 180 9.31e-56 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 93.1%
Validation Efficiency 97% (38/39)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik T C 18: 77,653,159 T285A probably benign Het
Api5 T C 2: 94,422,381 Y348C probably benign Het
Asap3 T C 4: 136,238,230 probably null Het
Atp11b T A 3: 35,839,162 V36E probably damaging Het
Atp13a4 C T 16: 29,479,841 S100N probably benign Het
C530008M17Rik A T 5: 76,866,100 probably benign Het
Cd27 T C 6: 125,236,793 T34A probably benign Het
Clec10a T C 11: 70,170,610 S274P probably benign Het
Cntnap2 C T 6: 46,170,272 T484I probably benign Het
Cpsf1 CCCCTGCATGAGGCAGGTCCC CCCC 15: 76,597,455 probably null Het
Def8 T C 8: 123,456,710 S304P probably benign Het
Dgkd G A 1: 87,940,240 V299M probably damaging Het
Ephb2 T C 4: 136,657,550 D850G probably damaging Het
Gjc1 T C 11: 102,800,304 N291S possibly damaging Het
Hc T C 2: 35,032,126 I563V probably benign Het
Hells C T 19: 38,931,465 Q20* probably null Het
Hid1 G C 11: 115,354,636 P448A possibly damaging Het
Igkv8-24 C T 6: 70,216,963 R87H possibly damaging Het
Irf6 A G 1: 193,169,354 S418G probably damaging Het
Kcnv2 T A 19: 27,324,020 C424S possibly damaging Het
Lmln T A 16: 33,107,000 probably null Het
Myo1a A T 10: 127,715,320 I678F possibly damaging Het
Nup98 A C 7: 102,128,846 probably null Het
Papolg GGACTTGGGATACTTACGCTTTG GG 11: 23,879,857 probably benign Het
Ppfibp1 T A 6: 146,999,655 probably null Het
Sardh T C 2: 27,218,855 T623A possibly damaging Het
Scml4 A G 10: 42,947,111 N251D probably damaging Het
Skap1 T C 11: 96,526,044 Y52H probably damaging Het
Srp68 G A 11: 116,265,464 R113W probably damaging Het
Srsf12 T C 4: 33,209,196 probably benign Het
Stat5b A G 11: 100,797,700 M312T probably benign Het
Tma7 T C 9: 109,082,194 probably benign Het
Tmem120b T G 5: 123,116,647 F304V probably damaging Het
Tns3 G A 11: 8,549,057 L9F probably damaging Het
Tns3 G T 11: 8,549,058 D8E probably damaging Het
Tsc2 C T 17: 24,610,499 A765T probably damaging Het
Uba1y A G Y: 825,465 I276V probably benign Homo
Upb1 T G 10: 75,412,889 L81R probably damaging Het
Uros C A 7: 133,700,840 C73F probably damaging Het
Zcchc6 C T 13: 59,808,161 C45Y probably damaging Het
Zfp820 T C 17: 21,819,403 I315V probably benign Het
Other mutations in Arl14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03301:Arl14 APN 3 69222943 missense probably damaging 1.00
R5665:Arl14 UTSW 3 69223038 missense probably damaging 1.00
R5894:Arl14 UTSW 3 69222676 missense probably benign 0.35
R6860:Arl14 UTSW 3 69222696 missense probably benign
Z1176:Arl14 UTSW 3 69222648 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACAAACAGGACTTGCCGGG -3'
(R):5'- TAGGACTTTCAAATCATCCAACACG -3'

Sequencing Primer
(F):5'- ACTTGCCGGGAGCTCTGAG -3'
(R):5'- AATGACCATTACCCCATAGTTTGC -3'
Posted On2018-06-22