Incidental Mutation 'R6611:1810009J06Rik'
ID523567
Institutional Source Beutler Lab
Gene Symbol 1810009J06Rik
Ensembl Gene ENSMUSG00000094808
Gene NameRIKEN cDNA 1810009J06 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R6611 (G1)
Quality Score93.0077
Status Not validated
Chromosome6
Chromosomal Location40964754-40968435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40966779 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 126 (T126S)
Ref Sequence ENSEMBL: ENSMUSP00000075935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076638]
Predicted Effect probably benign
Transcript: ENSMUST00000076638
AA Change: T126S

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000075935
Gene: ENSMUSG00000094808
AA Change: T126S

DomainStartEndE-ValueType
Tryp_SPc 23 240 4.94e-97 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bex6 A G 16: 32,186,665 K97R probably benign Het
Brca2 T C 5: 150,536,193 L311P probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdc16 C A 8: 13,781,512 P582T probably benign Het
Cep112 T C 11: 108,506,551 I280T possibly damaging Het
Chd2 A G 7: 73,493,565 F527L probably damaging Het
Drc3 G T 11: 60,364,947 R120L probably damaging Het
Efcab6 T A 15: 83,892,835 R1133S possibly damaging Het
Fer1l5 T C 1: 36,406,654 V834A probably benign Het
Flnb A G 14: 7,915,318 Y1483C probably damaging Het
Fstl4 A T 11: 53,186,725 M770L probably benign Het
Gm10428 A T 11: 62,753,289 probably benign Het
Gm4788 A G 1: 139,732,390 Y666H probably damaging Het
Hmbs C A 9: 44,341,691 R15L probably damaging Het
Irx3 T C 8: 91,800,003 T358A probably damaging Het
Kmt2a T A 9: 44,849,272 I460L probably damaging Het
Mob2 G T 7: 142,009,556 F55L probably damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Ntrk2 T C 13: 59,054,414 L612P probably damaging Het
Obscn A G 11: 59,064,230 probably null Het
Olfr1106 A T 2: 87,049,233 M1K probably null Het
Olfr907 A T 9: 38,499,238 T190S probably damaging Het
Olfr984 T C 9: 40,101,020 I157V probably benign Het
Oxct2a T C 4: 123,322,847 E247G probably damaging Het
Phykpl G T 11: 51,598,354 A336S probably damaging Het
Pik3r4 T G 9: 105,644,277 L14R probably damaging Het
Pnpla1 A G 17: 28,881,047 N296S probably benign Het
Pramel7 A G 2: 87,490,049 I300T probably damaging Het
Rictor T G 15: 6,750,659 C132G probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Slc9a9 G T 9: 94,939,478 R306L probably benign Het
Smc5 A G 19: 23,228,919 V681A probably benign Het
Snap91 C T 9: 86,790,127 S646N probably benign Het
Ssh3 T C 19: 4,264,422 N368S probably damaging Het
Syne1 A T 10: 5,045,273 N8326K probably benign Het
Traf3 T G 12: 111,237,640 L21R possibly damaging Het
Ubxn11 C A 4: 134,123,599 T254K probably damaging Het
Other mutations in 1810009J06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00741:1810009J06Rik APN 6 40964834 splice site probably benign
IGL00952:1810009J06Rik APN 6 40964799 missense probably benign 0.00
IGL01146:1810009J06Rik APN 6 40966283 missense probably damaging 1.00
IGL02815:1810009J06Rik APN 6 40964795 missense probably benign
R1543:1810009J06Rik UTSW 6 40968204 missense probably damaging 1.00
R1708:1810009J06Rik UTSW 6 40964798 missense probably benign
R1964:1810009J06Rik UTSW 6 40968207 missense probably damaging 1.00
R5786:1810009J06Rik UTSW 6 40968188 missense probably damaging 1.00
R7057:1810009J06Rik UTSW 6 40968247 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAATGCAGAAGACTCCAGGTTC -3'
(R):5'- GTGAAGCAATGTTCTGGCCTAC -3'

Sequencing Primer
(F):5'- CGCCTTGGTGAACACAATATTG -3'
(R):5'- TCTACAAGTATCTCTCACAGTGAC -3'
Posted On2018-06-22