Incidental Mutation 'R6611:Slc9a9'
ID523590
Institutional Source Beutler Lab
Gene Symbol Slc9a9
Ensembl Gene ENSMUSG00000031129
Gene Namesolute carrier family 9 (sodium/hydrogen exchanger), member 9
Synonyms5730527A11Rik, Nhe9
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6611 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location94669909-95230445 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 94939478 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 306 (R306L)
Ref Sequence ENSEMBL: ENSMUSP00000033463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033463]
Predicted Effect probably benign
Transcript: ENSMUST00000033463
AA Change: R306L

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000033463
Gene: ENSMUSG00000031129
AA Change: R306L

DomainStartEndE-ValueType
Pfam:Na_H_Exchanger 28 486 2.6e-89 PFAM
low complexity region 594 600 N/A INTRINSIC
low complexity region 621 635 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium/proton exchanger that is a member of the solute carrier 9 protein family. The encoded protein localizes the to the late recycling endosomes and may play an important role in maintaining cation homeostasis. Mutations in this gene are associated with autism susceptibility 16 and attention-deficit/hyperactivity disorder. [provided by RefSeq, Mar 2012]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik A T 6: 40,966,779 T126S probably benign Het
Bex6 A G 16: 32,186,665 K97R probably benign Het
Brca2 T C 5: 150,536,193 L311P probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdc16 C A 8: 13,781,512 P582T probably benign Het
Cep112 T C 11: 108,506,551 I280T possibly damaging Het
Chd2 A G 7: 73,493,565 F527L probably damaging Het
Drc3 G T 11: 60,364,947 R120L probably damaging Het
Efcab6 T A 15: 83,892,835 R1133S possibly damaging Het
Fer1l5 T C 1: 36,406,654 V834A probably benign Het
Flnb A G 14: 7,915,318 Y1483C probably damaging Het
Fstl4 A T 11: 53,186,725 M770L probably benign Het
Gm10428 A T 11: 62,753,289 probably benign Het
Gm4788 A G 1: 139,732,390 Y666H probably damaging Het
Hmbs C A 9: 44,341,691 R15L probably damaging Het
Irx3 T C 8: 91,800,003 T358A probably damaging Het
Kmt2a T A 9: 44,849,272 I460L probably damaging Het
Mob2 G T 7: 142,009,556 F55L probably damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Ntrk2 T C 13: 59,054,414 L612P probably damaging Het
Obscn A G 11: 59,064,230 probably null Het
Olfr1106 A T 2: 87,049,233 M1K probably null Het
Olfr907 A T 9: 38,499,238 T190S probably damaging Het
Olfr984 T C 9: 40,101,020 I157V probably benign Het
Oxct2a T C 4: 123,322,847 E247G probably damaging Het
Phykpl G T 11: 51,598,354 A336S probably damaging Het
Pik3r4 T G 9: 105,644,277 L14R probably damaging Het
Pnpla1 A G 17: 28,881,047 N296S probably benign Het
Pramel7 A G 2: 87,490,049 I300T probably damaging Het
Rictor T G 15: 6,750,659 C132G probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Smc5 A G 19: 23,228,919 V681A probably benign Het
Snap91 C T 9: 86,790,127 S646N probably benign Het
Ssh3 T C 19: 4,264,422 N368S probably damaging Het
Syne1 A T 10: 5,045,273 N8326K probably benign Het
Traf3 T G 12: 111,237,640 L21R possibly damaging Het
Ubxn11 C A 4: 134,123,599 T254K probably damaging Het
Other mutations in Slc9a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Slc9a9 APN 9 95055459 missense probably benign 0.03
IGL01394:Slc9a9 APN 9 95123037 missense probably benign
IGL01434:Slc9a9 APN 9 95019194 missense possibly damaging 0.49
IGL01715:Slc9a9 APN 9 94960446 missense probably damaging 1.00
IGL01821:Slc9a9 APN 9 95228950 missense probably benign
IGL02963:Slc9a9 APN 9 95020714 critical splice donor site probably null
IGL03211:Slc9a9 APN 9 95137990 splice site probably benign
ANU18:Slc9a9 UTSW 9 95055459 missense probably benign 0.03
R0306:Slc9a9 UTSW 9 95137934 missense probably benign
R0382:Slc9a9 UTSW 9 94685217 missense probably benign 0.18
R0388:Slc9a9 UTSW 9 94939563 critical splice donor site probably null
R1509:Slc9a9 UTSW 9 95228958 missense probably benign
R1785:Slc9a9 UTSW 9 95019193 missense possibly damaging 0.95
R4018:Slc9a9 UTSW 9 94685163 missense probably benign 0.03
R4167:Slc9a9 UTSW 9 95228899 missense probably damaging 0.98
R4170:Slc9a9 UTSW 9 95228899 missense probably damaging 0.98
R4695:Slc9a9 UTSW 9 94936449 critical splice donor site probably benign
R5400:Slc9a9 UTSW 9 94712901 missense probably damaging 1.00
R5609:Slc9a9 UTSW 9 94809937 missense probably damaging 1.00
R5684:Slc9a9 UTSW 9 95055508 missense possibly damaging 0.89
R6015:Slc9a9 UTSW 9 94939549 missense probably benign 0.29
R6102:Slc9a9 UTSW 9 94936429 missense probably benign 0.03
R6317:Slc9a9 UTSW 9 94939459 missense possibly damaging 0.51
R6398:Slc9a9 UTSW 9 94670227 missense probably benign 0.00
R6476:Slc9a9 UTSW 9 94685138 missense probably benign 0.00
R6501:Slc9a9 UTSW 9 94936371 missense probably benign 0.01
R6603:Slc9a9 UTSW 9 94939546 missense probably damaging 0.98
R6700:Slc9a9 UTSW 9 94936311 missense possibly damaging 0.66
R6824:Slc9a9 UTSW 9 95227198 missense probably damaging 1.00
R6931:Slc9a9 UTSW 9 94670086 missense possibly damaging 0.73
R6975:Slc9a9 UTSW 9 94960446 missense probably damaging 1.00
R6987:Slc9a9 UTSW 9 94669990 start gained probably benign
R7325:Slc9a9 UTSW 9 94712898 missense probably benign 0.24
R7374:Slc9a9 UTSW 9 95055489 missense possibly damaging 0.90
R7437:Slc9a9 UTSW 9 95228941 missense probably benign 0.00
R7614:Slc9a9 UTSW 9 94855739 missense probably damaging 1.00
R8412:Slc9a9 UTSW 9 95229039 missense probably damaging 1.00
R8501:Slc9a9 UTSW 9 94855739 missense probably damaging 1.00
R8514:Slc9a9 UTSW 9 94936365 missense probably benign 0.01
X0010:Slc9a9 UTSW 9 94685208 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GACGTCACGCTAACTCCTTG -3'
(R):5'- GCAGAGGCTGATTTTGATAGAATCC -3'

Sequencing Primer
(F):5'- ACGCTAACTCCTTGAGGCCTG -3'
(R):5'- CACTATTTAAGAGAGACTTCATTCCC -3'
Posted On2018-06-22