Incidental Mutation 'R6504:1700006A11Rik'
List |< first << previous [record 91 of 86095] next >> last >|
ID523598
Institutional Source Beutler Lab
Gene Symbol 1700006A11Rik
Ensembl Gene ENSMUSG00000027973
Gene NameRIKEN cDNA 1700006A11 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6504 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location124400989-124426040 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124419920 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 31 (T31A)
Ref Sequence ENSEMBL: ENSMUSP00000029598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029598] [ENSMUST00000198630]
Predicted Effect probably benign
Transcript: ENSMUST00000029598
AA Change: T31A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029598
Gene: ENSMUSG00000027973
AA Change: T31A

DomainStartEndE-ValueType
RhoGAP 78 251 3.63e-37 SMART
RhoGAP 377 543 3.19e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197975
Predicted Effect probably benign
Transcript: ENSMUST00000198630
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam12 A T 7: 133,929,984 H507Q probably damaging Het
Ampd1 A G 3: 103,099,595 D712G possibly damaging Het
Ap4m1 T A 5: 138,178,096 D351E probably benign Het
Celsr1 T C 15: 85,978,920 T1304A probably benign Het
Dhx36 G T 3: 62,488,639 A449E probably benign Het
Dmkn A T 7: 30,776,429 K2N possibly damaging Het
Dnah10 T C 5: 124,762,782 I1217T possibly damaging Het
Dph5 A G 3: 115,926,803 probably null Het
Dysf T C 6: 84,008,925 V4A probably benign Het
Elavl4 A T 4: 110,255,382 probably null Het
Ep400 T C 5: 110,708,837 probably benign Het
Fat2 A G 11: 55,262,397 I3663T probably benign Het
Gm7233 T A 14: 43,179,937 D15E probably benign Het
Grik2 A G 10: 49,356,102 V444A probably damaging Het
Hdac4 T A 1: 91,968,455 I698F possibly damaging Het
Kank1 T C 19: 25,428,154 S1179P probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Ofcc1 A T 13: 40,097,055 L595Q probably damaging Het
Olfr1464-ps1 A C 19: 13,282,484 H191Q possibly damaging Het
Olfr958 C T 9: 39,550,278 V198M probably damaging Het
Orc1 A G 4: 108,590,717 I54V probably benign Het
Pom121l2 A G 13: 21,983,461 Q634R possibly damaging Het
Prrc2c A G 1: 162,697,795 V414A unknown Het
Ranbp3l T C 15: 8,968,462 F13L probably benign Het
Scaf11 T C 15: 96,419,460 probably null Het
Sh3d19 A G 3: 86,085,336 T224A probably benign Het
Shq1 T A 6: 100,648,247 Y217F probably benign Het
Slitrk1 A T 14: 108,911,697 H527Q probably benign Het
Smap2 GACTCTAC GAC 4: 120,973,085 probably benign Het
Stxbp1 T C 2: 32,801,883 I432M possibly damaging Het
Sulf2 A G 2: 166,083,921 Y439H probably benign Het
Thoc5 T A 11: 4,924,815 C535* probably null Het
Tlr3 T C 8: 45,397,449 I280V possibly damaging Het
Ush2a A G 1: 188,911,247 S4269G probably benign Het
Vmn1r214 A T 13: 23,035,440 *368L probably null Het
Wif1 C G 10: 121,035,091 Q92E probably damaging Het
Other mutations in 1700006A11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:1700006A11Rik APN 3 124401409 missense probably benign 0.30
IGL02552:1700006A11Rik APN 3 124414496 missense probably damaging 1.00
IGL03092:1700006A11Rik APN 3 124406470 missense probably damaging 1.00
R0094:1700006A11Rik UTSW 3 124409778 splice site probably benign
R0097:1700006A11Rik UTSW 3 124412480 missense probably benign 0.13
R0097:1700006A11Rik UTSW 3 124412480 missense probably benign 0.13
R0184:1700006A11Rik UTSW 3 124419250 missense probably damaging 1.00
R0361:1700006A11Rik UTSW 3 124413634 missense possibly damaging 0.69
R1542:1700006A11Rik UTSW 3 124414406 missense possibly damaging 0.95
R1549:1700006A11Rik UTSW 3 124416792 missense probably benign 0.00
R1779:1700006A11Rik UTSW 3 124406514 missense probably damaging 0.99
R1839:1700006A11Rik UTSW 3 124409720 missense probably damaging 0.99
R1986:1700006A11Rik UTSW 3 124419328 missense probably damaging 0.99
R2042:1700006A11Rik UTSW 3 124416728 splice site probably benign
R2149:1700006A11Rik UTSW 3 124409686 missense probably benign 0.33
R2258:1700006A11Rik UTSW 3 124413618 missense possibly damaging 0.84
R2291:1700006A11Rik UTSW 3 124413801 missense probably damaging 1.00
R2509:1700006A11Rik UTSW 3 124406453 missense probably benign 0.44
R4912:1700006A11Rik UTSW 3 124419856 missense possibly damaging 0.68
R5074:1700006A11Rik UTSW 3 124416833 missense probably benign 0.01
R5303:1700006A11Rik UTSW 3 124406350 missense probably damaging 1.00
R5307:1700006A11Rik UTSW 3 124406350 missense probably damaging 1.00
R5308:1700006A11Rik UTSW 3 124406350 missense probably damaging 1.00
R5796:1700006A11Rik UTSW 3 124421428 missense possibly damaging 0.66
R6018:1700006A11Rik UTSW 3 124416799 missense probably damaging 1.00
R6198:1700006A11Rik UTSW 3 124416850 splice site probably null
X0063:1700006A11Rik UTSW 3 124419862 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAAGCAGTATTTTGTCTTCAGGGTG -3'
(R):5'- CAGTGTTGAGTCTAGGGCAG -3'

Sequencing Primer
(F):5'- CTTCAGGGTGGCTAGGGAAG -3'
(R):5'- AAAAACTCCCACATGCTACAAC -3'
Posted On2018-06-22