Incidental Mutation 'R6611:Ntrk2'
ID523607
Institutional Source Beutler Lab
Gene Symbol Ntrk2
Ensembl Gene ENSMUSG00000055254
Gene Nameneurotrophic tyrosine kinase, receptor, type 2
SynonymsC030027L06Rik, Tkrb, trkB
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.899) question?
Stock #R6611 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location58806569-59133970 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59054414 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 612 (L612P)
Ref Sequence ENSEMBL: ENSMUSP00000153553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079828] [ENSMUST00000225488]
Predicted Effect probably damaging
Transcript: ENSMUST00000079828
AA Change: L612P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078757
Gene: ENSMUSG00000055254
AA Change: L612P

DomainStartEndE-ValueType
LRRNT 31 65 1.74e-4 SMART
LRRCT 148 195 8.56e-10 SMART
IGc2 209 273 4.43e-5 SMART
Pfam:I-set 298 377 1.2e-8 PFAM
transmembrane domain 431 453 N/A INTRINSIC
TyrKc 537 806 2.48e-142 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225244
Predicted Effect probably damaging
Transcript: ENSMUST00000225488
AA Change: L612P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurotrophic tyrosine receptor kinase (NTRK) family. This kinase is a membrane-bound receptor that, upon neurotrophin binding, phosphorylates itself and members of the MAPK pathway. Signalling through this kinase leads to cell differentiation. Mutations in this gene have been associated with obesity and mood disorders. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Different lines of homozygous mice show varied abnormalities including innervation and neural defects, rod defects, impaired ovarian folliculogenesis, and reduced postnatal survival. Homozygotes for a point mutation are normal, but are subject to pharmacological control of signalling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810009J06Rik A T 6: 40,966,779 T126S probably benign Het
Bex6 A G 16: 32,186,665 K97R probably benign Het
Brca2 T C 5: 150,536,193 L311P probably damaging Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdc16 C A 8: 13,781,512 P582T probably benign Het
Cep112 T C 11: 108,506,551 I280T possibly damaging Het
Chd2 A G 7: 73,493,565 F527L probably damaging Het
Drc3 G T 11: 60,364,947 R120L probably damaging Het
Efcab6 T A 15: 83,892,835 R1133S possibly damaging Het
Fer1l5 T C 1: 36,406,654 V834A probably benign Het
Flnb A G 14: 7,915,318 Y1483C probably damaging Het
Fstl4 A T 11: 53,186,725 M770L probably benign Het
Gm10428 A T 11: 62,753,289 probably benign Het
Gm4788 A G 1: 139,732,390 Y666H probably damaging Het
Hmbs C A 9: 44,341,691 R15L probably damaging Het
Irx3 T C 8: 91,800,003 T358A probably damaging Het
Kmt2a T A 9: 44,849,272 I460L probably damaging Het
Mob2 G T 7: 142,009,556 F55L probably damaging Het
Muc6 G C 7: 141,640,433 probably benign Het
Obscn A G 11: 59,064,230 probably null Het
Olfr1106 A T 2: 87,049,233 M1K probably null Het
Olfr907 A T 9: 38,499,238 T190S probably damaging Het
Olfr984 T C 9: 40,101,020 I157V probably benign Het
Oxct2a T C 4: 123,322,847 E247G probably damaging Het
Phykpl G T 11: 51,598,354 A336S probably damaging Het
Pik3r4 T G 9: 105,644,277 L14R probably damaging Het
Pnpla1 A G 17: 28,881,047 N296S probably benign Het
Pramel7 A G 2: 87,490,049 I300T probably damaging Het
Rictor T G 15: 6,750,659 C132G probably damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Slc9a9 G T 9: 94,939,478 R306L probably benign Het
Smc5 A G 19: 23,228,919 V681A probably benign Het
Snap91 C T 9: 86,790,127 S646N probably benign Het
Ssh3 T C 19: 4,264,422 N368S probably damaging Het
Syne1 A T 10: 5,045,273 N8326K probably benign Het
Traf3 T G 12: 111,237,640 L21R possibly damaging Het
Ubxn11 C A 4: 134,123,599 T254K probably damaging Het
Other mutations in Ntrk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01928:Ntrk2 APN 13 58846851 missense probably damaging 1.00
IGL02331:Ntrk2 APN 13 58846856 critical splice donor site probably null
IGL02465:Ntrk2 APN 13 59060380 missense probably damaging 1.00
PIT4366001:Ntrk2 UTSW 13 59060335 missense probably damaging 1.00
R0102:Ntrk2 UTSW 13 58808793 missense probably benign 0.00
R0547:Ntrk2 UTSW 13 58874370 missense probably damaging 0.99
R0615:Ntrk2 UTSW 13 59128186 nonsense probably null
R0620:Ntrk2 UTSW 13 58846821 missense probably benign
R1770:Ntrk2 UTSW 13 58861318 missense possibly damaging 0.67
R2063:Ntrk2 UTSW 13 58859297 missense probably damaging 1.00
R2089:Ntrk2 UTSW 13 58859301 missense possibly damaging 0.95
R2091:Ntrk2 UTSW 13 58859301 missense possibly damaging 0.95
R2091:Ntrk2 UTSW 13 58859301 missense possibly damaging 0.95
R2178:Ntrk2 UTSW 13 58808802 missense probably benign 0.06
R2275:Ntrk2 UTSW 13 58861351 missense probably damaging 1.00
R2370:Ntrk2 UTSW 13 59054434 missense probably benign 0.28
R2413:Ntrk2 UTSW 13 58874412 missense possibly damaging 0.56
R2520:Ntrk2 UTSW 13 59054276 intron probably null
R2926:Ntrk2 UTSW 13 59060284 missense probably damaging 1.00
R4163:Ntrk2 UTSW 13 58860240 missense probably damaging 1.00
R4320:Ntrk2 UTSW 13 58860146 missense possibly damaging 0.48
R4348:Ntrk2 UTSW 13 58878259 missense probably damaging 1.00
R4440:Ntrk2 UTSW 13 59060312 missense probably damaging 1.00
R4534:Ntrk2 UTSW 13 59126529 missense probably damaging 1.00
R4695:Ntrk2 UTSW 13 59126493 missense probably damaging 0.99
R5356:Ntrk2 UTSW 13 59060242 missense probably damaging 1.00
R5471:Ntrk2 UTSW 13 58871760 missense probably benign 0.01
R5750:Ntrk2 UTSW 13 58808922 missense probably benign 0.02
R5916:Ntrk2 UTSW 13 58808729 start codon destroyed probably null 0.98
R5972:Ntrk2 UTSW 13 58837819 missense probably damaging 1.00
R6015:Ntrk2 UTSW 13 59060395 missense probably damaging 1.00
R6298:Ntrk2 UTSW 13 58871756 nonsense probably null
R6419:Ntrk2 UTSW 13 58861299 nonsense probably null
R6488:Ntrk2 UTSW 13 58861356 missense possibly damaging 0.93
R6827:Ntrk2 UTSW 13 59126568 missense probably damaging 1.00
R6911:Ntrk2 UTSW 13 58859215 missense probably damaging 1.00
R7387:Ntrk2 UTSW 13 58985979 missense probably damaging 1.00
R7445:Ntrk2 UTSW 13 58846762 missense probably benign 0.03
R7561:Ntrk2 UTSW 13 58861388 missense probably benign 0.31
R8031:Ntrk2 UTSW 13 58874379 missense probably benign
R8044:Ntrk2 UTSW 13 59126499 missense probably damaging 1.00
Z1176:Ntrk2 UTSW 13 58874333 missense probably benign
Z1177:Ntrk2 UTSW 13 58859273 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTGGAATCCCTTATCCAAAC -3'
(R):5'- CCCCTTCACTAAACCCAGGTTG -3'

Sequencing Primer
(F):5'- TGGAATCCCTTATCCAAACAACTTTC -3'
(R):5'- CCTCTCTAAGCCCAGGTTGG -3'
Posted On2018-06-22