Incidental Mutation 'R6504:Olfr958'
ID523624
Institutional Source Beutler Lab
Gene Symbol Olfr958
Ensembl Gene ENSMUSG00000050853
Gene Nameolfactory receptor 958
SynonymsMOR224-9, GA_x6K02T2PVTD-33247839-33246901
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R6504 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location39547958-39554054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39550278 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 198 (V198M)
Ref Sequence ENSEMBL: ENSMUSP00000149788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062545] [ENSMUST00000215505] [ENSMUST00000217227]
Predicted Effect probably damaging
Transcript: ENSMUST00000062545
AA Change: V198M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049930
Gene: ENSMUSG00000050853
AA Change: V198M

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 1.1e-49 PFAM
Pfam:7TM_GPCR_Srsx 36 236 1.5e-6 PFAM
Pfam:7tm_1 41 288 3.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215505
AA Change: V198M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217227
AA Change: V198M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.5%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,419,920 T31A probably benign Het
Adam12 A T 7: 133,929,984 H507Q probably damaging Het
Ampd1 A G 3: 103,099,595 D712G possibly damaging Het
Ap4m1 T A 5: 138,178,096 D351E probably benign Het
Celsr1 T C 15: 85,978,920 T1304A probably benign Het
Dhx36 G T 3: 62,488,639 A449E probably benign Het
Dmkn A T 7: 30,776,429 K2N possibly damaging Het
Dnah10 T C 5: 124,762,782 I1217T possibly damaging Het
Dph5 A G 3: 115,926,803 probably null Het
Dysf T C 6: 84,008,925 V4A probably benign Het
Elavl4 A T 4: 110,255,382 probably null Het
Ep400 T C 5: 110,708,837 probably benign Het
Fat2 A G 11: 55,262,397 I3663T probably benign Het
Gm7233 T A 14: 43,179,937 D15E probably benign Het
Grik2 A G 10: 49,356,102 V444A probably damaging Het
Hdac4 T A 1: 91,968,455 I698F possibly damaging Het
Kank1 T C 19: 25,428,154 S1179P probably damaging Het
Kif1b T C 4: 149,192,596 M1337V probably benign Het
Med13l T A 5: 118,754,321 D1936E probably benign Het
Ofcc1 A T 13: 40,097,055 L595Q probably damaging Het
Olfr1464-ps1 A C 19: 13,282,484 H191Q possibly damaging Het
Orc1 A G 4: 108,590,717 I54V probably benign Het
Pom121l2 A G 13: 21,983,461 Q634R possibly damaging Het
Prrc2c A G 1: 162,697,795 V414A unknown Het
Ranbp3l T C 15: 8,968,462 F13L probably benign Het
Scaf11 T C 15: 96,419,460 probably null Het
Sh3d19 A G 3: 86,085,336 T224A probably benign Het
Shq1 T A 6: 100,648,247 Y217F probably benign Het
Slitrk1 A T 14: 108,911,697 H527Q probably benign Het
Smap2 GACTCTAC GAC 4: 120,973,085 probably benign Het
Stxbp1 T C 2: 32,801,883 I432M possibly damaging Het
Sulf2 A G 2: 166,083,921 Y439H probably benign Het
Thoc5 T A 11: 4,924,815 C535* probably null Het
Tlr3 T C 8: 45,397,449 I280V possibly damaging Het
Ush2a A G 1: 188,911,247 S4269G probably benign Het
Vmn1r214 A T 13: 23,035,440 *368L probably null Het
Wif1 C G 10: 121,035,091 Q92E probably damaging Het
Other mutations in Olfr958
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0446:Olfr958 UTSW 9 39550451 missense probably damaging 0.96
R0539:Olfr958 UTSW 9 39550297 missense probably damaging 0.99
R1512:Olfr958 UTSW 9 39550094 missense probably damaging 1.00
R1521:Olfr958 UTSW 9 39550784 missense possibly damaging 0.65
R1652:Olfr958 UTSW 9 39550295 missense probably benign 0.03
R2099:Olfr958 UTSW 9 39550667 missense probably benign 0.17
R2252:Olfr958 UTSW 9 39549977 missense probably damaging 0.99
R2911:Olfr958 UTSW 9 39550821 missense possibly damaging 0.76
R3722:Olfr958 UTSW 9 39550122 missense probably damaging 1.00
R5745:Olfr958 UTSW 9 39550691 missense probably damaging 1.00
R6460:Olfr958 UTSW 9 39550792 frame shift probably null
R7063:Olfr958 UTSW 9 39550115 missense possibly damaging 0.87
R7162:Olfr958 UTSW 9 39550229 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATAGGTCCATAGGCACAGAGG -3'
(R):5'- GACCGCTTTGCTGCCATTTG -3'

Sequencing Primer
(F):5'- TCCATAGGCACAGAGGATAGC -3'
(R):5'- CGGTACTCGGTCATCATGAAC -3'
Posted On2018-06-22