Mutagenetix > Incidental Mutation

Incidental Mutation 'R6505:Speg'

523662

Institutional Source

Beutler Lab

Gene Symbol

Speg

Ensembl Gene

ENSMUSG00000026207

Gene Name

SPEG complex locus

Synonyms

SPEGbeta, Apeg1, SPEGalpha, D1Bwg1450e, SPEG, BPEG

MMRRC Submission

044637-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6505 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75375297-75432320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 75429523 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 3091 (D3091E)

Ref Sequence

ENSEMBL: ENSMUSP00000084361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087122]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000087122
AA Change: D3091E

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: D3091E

Domain	Start	End	E-Value	Type
IG	51	128	1.48e-6	SMART
low complexity region	292	318	N/A	INTRINSIC
low complexity region	325	338	N/A	INTRINSIC
low complexity region	359	368	N/A	INTRINSIC
low complexity region	412	423	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
IGc2	739	806	2.19e-9	SMART
Pfam:SPEG_u2	817	873	2.4e-36	PFAM
IGc2	886	954	4.03e-8	SMART
IG	979	1064	1.05e-6	SMART
IGc2	1081	1148	2.19e-9	SMART
IG	1199	1283	6.87e-2	SMART
FN3	1287	1373	1.38e-4	SMART
IG	1401	1487	2.64e-3	SMART
IGc2	1502	1569	1.12e-6	SMART
STYKc	1606	1859	8.44e-63	SMART
Blast:STYKc	1861	1895	6e-12	BLAST
low complexity region	1918	1939	N/A	INTRINSIC
low complexity region	2069	2081	N/A	INTRINSIC
low complexity region	2208	2227	N/A	INTRINSIC
low complexity region	2230	2249	N/A	INTRINSIC
low complexity region	2255	2269	N/A	INTRINSIC
low complexity region	2343	2366	N/A	INTRINSIC
low complexity region	2410	2422	N/A	INTRINSIC
low complexity region	2433	2451	N/A	INTRINSIC
low complexity region	2457	2487	N/A	INTRINSIC
low complexity region	2524	2544	N/A	INTRINSIC
IGc2	2599	2667	2.05e-9	SMART
FN3	2681	2760	2.5e-2	SMART
low complexity region	2775	2789	N/A	INTRINSIC
low complexity region	2802	2831	N/A	INTRINSIC
low complexity region	2912	2927	N/A	INTRINSIC
STYKc	2961	3213	4.42e-66	SMART
low complexity region	3241	3250	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000137868
AA Change: D2838E

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143679

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

100% (84/84)

MGI Phenotype

FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	A	T	17: 9,001,940	I424L	probably benign	Het
2610028H24Rik	C	T	10: 76,449,281	A8V	probably benign	Het
Ago1	G	A	4: 126,463,835	P16S	probably benign	Het
Ak5	C	T	3: 152,481,669	E394K	probably benign	Het
Aldh7a1	T	C	18: 56,526,996	Y498C	probably damaging	Het
Alox12	T	A	11: 70,250,204	D335V	probably damaging	Het
Alx4	A	T	2: 93,668,559	Y212F	probably damaging	Het
Asb16	A	G	11: 102,276,477	E223G	probably damaging	Het
Atg9b	C	T	5: 24,390,577	V235M	probably damaging	Het
BB014433	A	G	8: 15,042,304	V183A	probably benign	Het
Brca1	T	A	11: 101,523,541	M1256L	probably benign	Het
Bst1	A	G	5: 43,820,590	I94V	probably benign	Het
C3ar1	A	G	6: 122,850,640	L206P	probably benign	Het
Cabs1	T	A	5: 87,980,663	M391K	possibly damaging	Het
Cars	C	T	7: 143,565,007	R599Q	probably damaging	Het
Ccdc190	T	A	1: 169,933,023	Y73*	probably null	Het
Cd177	A	C	7: 24,744,246	L809W	probably benign	Het
Cemip	C	A	7: 83,951,597	G939*	probably null	Het
Clca3b	T	A	3: 144,825,259	I777F	probably benign	Het
Cma2	T	C	14: 55,973,779	I176T	probably damaging	Het
Col12a1	T	A	9: 79,647,605	T2064S	probably damaging	Het
Csf1r	A	G	18: 61,129,733	N860S	probably damaging	Het
Dab1	T	A	4: 104,512,264	C3S	probably benign	Het
Dennd4b	A	G	3: 90,267,611	E50G	probably damaging	Het
Dis3l	A	T	9: 64,307,513	S925T	probably benign	Het
Disp1	T	C	1: 183,086,512	N1448S	probably benign	Het
Dpp10	T	C	1: 123,336,851	I747M	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Ephx4	A	T	5: 107,403,656	K36*	probably null	Het
Fam135a	C	T	1: 24,014,872	V1195I	probably damaging	Het
Fap	A	T	2: 62,546,603	Y234*	probably null	Het
Fem1c	A	T	18: 46,505,875	N353K	possibly damaging	Het
Furin	C	A	7: 80,393,617	R282L	probably damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm5930	A	G	14: 44,331,371	*265Q	probably null	Het
Hcrtr1	T	A	4: 130,137,586	T15S	probably benign	Het
Ifnar1	C	T	16: 91,499,537	Q309*	probably null	Het
Il18r1	A	T	1: 40,489,707	I304L	probably benign	Het
Ino80	A	T	2: 119,451,441	Y185N	probably damaging	Het
Itgb2	G	A	10: 77,559,673	C536Y	probably damaging	Het
Ivns1abp	T	C	1: 151,360,993	M435T	probably benign	Het
Kcnh4	T	C	11: 100,757,085	N151D	probably benign	Het
Lama3	T	C	18: 12,495,348	M1499T	probably benign	Het
Lamb1	A	T	12: 31,323,462	T1397S	possibly damaging	Het
Leng1	G	A	7: 3,661,212	R239*	probably null	Het
Map2k4	A	T	11: 65,693,529	N309K	possibly damaging	Het
Mcm3	A	G	1: 20,803,544	F784S	probably damaging	Het
Mrgpra9	T	A	7: 47,235,136	N260I	probably benign	Het
Mrnip	C	A	11: 50,199,852	T281N	possibly damaging	Het
Myo9b	A	G	8: 71,355,857	T1715A	possibly damaging	Het
Nectin3	A	G	16: 46,448,821	I406T	possibly damaging	Het
Neto1	A	G	18: 86,498,574	T339A	possibly damaging	Het
Ntn1	T	C	11: 68,213,199	D541G	probably damaging	Het
Nuak2	C	A	1: 132,316,394	H55Q	probably damaging	Het
Nufip2	A	G	11: 77,691,613	T118A	probably benign	Het
Olfr1126	T	A	2: 87,457,927	V254E	probably damaging	Het
Olfr1155	A	T	2: 87,943,174	Y151*	probably null	Het
Olfr19	A	T	16: 16,673,920	D20E	probably benign	Het
Olfr213	C	T	6: 116,540,600	T49M	probably benign	Het
Olfr266	T	G	3: 106,822,322	N79T	possibly damaging	Het
Olfr483	T	C	7: 108,103,567	V86A	probably benign	Het
Olfr596	C	A	7: 103,309,793	A24D	probably benign	Het
Olfr609	T	A	7: 103,492,651	T76S	probably damaging	Het
Olfr847	T	C	9: 19,374,941	*313W	probably null	Het
Pcdhb5	T	A	18: 37,320,880	H104Q	probably benign	Het
Phf11a	T	C	14: 59,277,537	R232G	probably damaging	Het
Pik3r5	C	T	11: 68,492,789	T478I	probably benign	Het
Prkacb	T	A	3: 146,732,646	E380V	probably damaging	Het
Prl7c1	G	T	13: 27,773,793	D221E	probably damaging	Het
Prr11	T	A	11: 87,106,124	K5*	probably null	Het
Prrc2b	G	A	2: 32,222,320	G1932D	probably damaging	Het
Rexo1	A	T	10: 80,543,011	Y1064N	possibly damaging	Het
Rnf182	C	T	13: 43,668,671	Q233*	probably null	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Sash1	C	G	10: 8,729,527	G1033A	probably benign	Het
Sncaip	C	A	18: 52,906,537	S189*	probably null	Het
Sorl1	T	C	9: 42,071,234	Y350C	probably damaging	Het
Sucnr1	A	T	3: 60,086,723	D224V	probably benign	Het
Tg	G	A	15: 66,759,558	A559T	probably damaging	Het
Tmem132d	A	G	5: 127,784,438	I873T	probably benign	Het
Tmem229a	C	T	6: 24,954,921	C278Y	probably damaging	Het
Togaram1	T	C	12: 64,966,590	I205T	possibly damaging	Het
Usp19	T	A	9: 108,496,883	L713Q	probably damaging	Het
Vsig10	A	G	5: 117,351,759	D530G	possibly damaging	Het
Zfp106	A	G	2: 120,534,502	S475P	probably damaging	Het

Other mutations in Speg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00838:Speg	APN	1	75410390	missense	possibly damaging	0.95
IGL00979:Speg	APN	1	75410734	missense	probably damaging	0.98
IGL01122:Speg	APN	1	75410035	missense	probably damaging	1.00
IGL01293:Speg	APN	1	75388102	missense	probably damaging	1.00
IGL01304:Speg	APN	1	75428197	missense	probably benign	0.00
IGL01351:Speg	APN	1	75411276	splice site	probably benign
IGL01473:Speg	APN	1	75428285	missense	possibly damaging	0.53
IGL01477:Speg	APN	1	75391897	missense	probably damaging	1.00
IGL01485:Speg	APN	1	75387827	missense	probably damaging	1.00
IGL01584:Speg	APN	1	75430937	missense	probably damaging	1.00
IGL01959:Speg	APN	1	75391090	missense	probably damaging	1.00
IGL02231:Speg	APN	1	75423387	missense	probably damaging	1.00
IGL02355:Speg	APN	1	75423915	missense	possibly damaging	0.49
IGL02362:Speg	APN	1	75423915	missense	possibly damaging	0.49
IGL03013:Speg	APN	1	75431279	missense	probably damaging	0.97
IGL03168:Speg	APN	1	75388187	missense	probably damaging	1.00
H8562:Speg	UTSW	1	75415597	missense	probably benign	0.39
R0112:Speg	UTSW	1	75385032	missense	possibly damaging	0.92
R0311:Speg	UTSW	1	75430937	missense	probably damaging	1.00
R0315:Speg	UTSW	1	75415136	missense	possibly damaging	0.88
R0393:Speg	UTSW	1	75423924	missense	possibly damaging	0.46
R0403:Speg	UTSW	1	75430784	splice site	probably benign
R0483:Speg	UTSW	1	75385032	missense	possibly damaging	0.92
R0648:Speg	UTSW	1	75427978	missense	probably benign
R0683:Speg	UTSW	1	75429118	missense	probably damaging	1.00
R0800:Speg	UTSW	1	75423489	missense	probably damaging	1.00
R0815:Speg	UTSW	1	75415392	missense	probably damaging	1.00
R0835:Speg	UTSW	1	75375674	missense	probably benign	0.00
R0866:Speg	UTSW	1	75417083	missense	probably damaging	0.99
R0880:Speg	UTSW	1	75405061	missense	probably damaging	1.00
R1082:Speg	UTSW	1	75415138	missense	possibly damaging	0.94
R1140:Speg	UTSW	1	75429095	missense	probably damaging	1.00
R1252:Speg	UTSW	1	75427095	missense	probably damaging	1.00
R1301:Speg	UTSW	1	75401501	missense	probably damaging	1.00
R1348:Speg	UTSW	1	75422872	missense	probably damaging	0.99
R1388:Speg	UTSW	1	75430460	missense	probably damaging	0.99
R1465:Speg	UTSW	1	75428484	splice site	probably benign
R1505:Speg	UTSW	1	75375542	missense	probably benign	0.02
R1506:Speg	UTSW	1	75417663	missense	probably benign	0.03
R1531:Speg	UTSW	1	75401222	missense	possibly damaging	0.86
R1543:Speg	UTSW	1	75421951	missense	probably damaging	1.00
R1567:Speg	UTSW	1	75428047	missense	probably benign
R1630:Speg	UTSW	1	75422977	missense	probably damaging	1.00
R1667:Speg	UTSW	1	75410549	splice site	probably benign
R1673:Speg	UTSW	1	75411163	missense	possibly damaging	0.60
R1718:Speg	UTSW	1	75417863	missense	probably benign	0.00
R1718:Speg	UTSW	1	75421744	missense	possibly damaging	0.87
R1719:Speg	UTSW	1	75417863	missense	probably benign	0.00
R1759:Speg	UTSW	1	75401162	missense	possibly damaging	0.95
R1861:Speg	UTSW	1	75389005	missense	probably damaging	1.00
R1874:Speg	UTSW	1	75423906	missense	probably benign
R1936:Speg	UTSW	1	75431408	missense	possibly damaging	0.93
R2192:Speg	UTSW	1	75417727	missense	probably damaging	1.00
R2204:Speg	UTSW	1	75430477	missense	probably benign	0.30
R2287:Speg	UTSW	1	75430465	missense	possibly damaging	0.76
R2696:Speg	UTSW	1	75406926	missense	probably benign	0.27
R2983:Speg	UTSW	1	75384930	missense	possibly damaging	0.83
R3110:Speg	UTSW	1	75422682	nonsense	probably null
R3112:Speg	UTSW	1	75422682	nonsense	probably null
R3154:Speg	UTSW	1	75401542	missense	probably damaging	1.00
R3720:Speg	UTSW	1	75426782	missense	probably damaging	1.00
R3983:Speg	UTSW	1	75422547	missense	probably benign	0.27
R4133:Speg	UTSW	1	75427904	missense	probably benign
R4522:Speg	UTSW	1	75428330	missense	probably damaging	1.00
R4564:Speg	UTSW	1	75391834	missense	probably damaging	1.00
R4577:Speg	UTSW	1	75415395	missense	probably damaging	1.00
R4858:Speg	UTSW	1	75421735	missense	probably damaging	1.00
R4953:Speg	UTSW	1	75423864	missense	possibly damaging	0.72
R4965:Speg	UTSW	1	75427703	missense	probably damaging	1.00
R4967:Speg	UTSW	1	75387869	missense	probably damaging	1.00
R5152:Speg	UTSW	1	75428098	missense	possibly damaging	0.92
R5156:Speg	UTSW	1	75428087	missense	probably damaging	0.99
R5371:Speg	UTSW	1	75431393	missense	possibly damaging	0.50
R5550:Speg	UTSW	1	75429100	missense	probably damaging	1.00
R5562:Speg	UTSW	1	75427056	missense	probably damaging	1.00
R5687:Speg	UTSW	1	75419129	splice site	probably null
R5985:Speg	UTSW	1	75406684	missense	possibly damaging	0.94
R6004:Speg	UTSW	1	75415603	nonsense	probably null
R6038:Speg	UTSW	1	75418459	critical splice donor site	probably null
R6038:Speg	UTSW	1	75418459	critical splice donor site	probably null
R6143:Speg	UTSW	1	75414387	missense	probably damaging	1.00
R6265:Speg	UTSW	1	75406679	nonsense	probably null
R6347:Speg	UTSW	1	75426875	missense	probably benign	0.00
R6453:Speg	UTSW	1	75417972	missense	probably benign	0.06
R6505:Speg	UTSW	1	75406684	missense	possibly damaging	0.94
R6531:Speg	UTSW	1	75422757	missense	probably benign	0.03
R6566:Speg	UTSW	1	75388463	missense	probably damaging	1.00
R6747:Speg	UTSW	1	75410395	critical splice donor site	probably null
R6819:Speg	UTSW	1	75391812	missense	possibly damaging	0.56
R6821:Speg	UTSW	1	75417903	missense	possibly damaging	0.83
R6919:Speg	UTSW	1	75387908	nonsense	probably null
R6981:Speg	UTSW	1	75430913	missense	probably damaging	1.00
R7002:Speg	UTSW	1	75423268	missense	probably damaging	0.98
R7082:Speg	UTSW	1	75411447	missense	probably damaging	0.96
R7140:Speg	UTSW	1	75406770	critical splice donor site	probably null
R7175:Speg	UTSW	1	75422490	missense	probably benign	0.01
R7178:Speg	UTSW	1	75422383	missense	possibly damaging	0.46
R7345:Speg	UTSW	1	75384835	missense	probably damaging	0.97
R7420:Speg	UTSW	1	75430905	missense	probably damaging	1.00
R7537:Speg	UTSW	1	75401464	missense	probably damaging	1.00
R7562:Speg	UTSW	1	75431279	missense	probably damaging	0.97
R7615:Speg	UTSW	1	75429242	missense	probably damaging	1.00
R7679:Speg	UTSW	1	75406315	missense	probably damaging	1.00
R7692:Speg	UTSW	1	75401190	missense	probably benign	0.04
R7696:Speg	UTSW	1	75429161	missense	probably damaging	1.00
R7719:Speg	UTSW	1	75375825	missense	probably damaging	1.00
R7794:Speg	UTSW	1	75388870	missense	probably benign	0.00
R7824:Speg	UTSW	1	75384017	splice site	probably null
R7834:Speg	UTSW	1	75384927	missense	probably damaging	1.00
R7892:Speg	UTSW	1	75427166	missense	probably damaging	1.00
R8015:Speg	UTSW	1	75415421	splice site	probably benign
R8068:Speg	UTSW	1	75422250	missense	probably damaging	1.00
R8085:Speg	UTSW	1	75415353	missense	probably damaging	1.00
R8130:Speg	UTSW	1	75415596	missense	probably damaging	1.00
R8132:Speg	UTSW	1	75422995	missense	probably damaging	1.00
R8239:Speg	UTSW	1	75419033	missense	probably damaging	1.00
R8287:Speg	UTSW	1	75422236	missense	probably benign	0.26
R8299:Speg	UTSW	1	75387836	missense	possibly damaging	0.95
R8441:Speg	UTSW	1	75411332	missense	possibly damaging	0.60
R8468:Speg	UTSW	1	75431309	missense	probably damaging	1.00
R8555:Speg	UTSW	1	75402264	splice site	probably null
R8781:Speg	UTSW	1	75407021	missense	probably damaging	1.00
R8784:Speg	UTSW	1	75405149	critical splice donor site	probably benign
R8848:Speg	UTSW	1	75427438	critical splice donor site	probably null
R8881:Speg	UTSW	1	75401151	missense	possibly damaging	0.67
R8898:Speg	UTSW	1	75388873	missense	probably damaging	1.00
R8935:Speg	UTSW	1	75422606	missense	probably benign	0.30
R9019:Speg	UTSW	1	75429238	missense	probably damaging	1.00
R9027:Speg	UTSW	1	75388432	missense	possibly damaging	0.67
R9066:Speg	UTSW	1	75385010	missense	probably damaging	0.99
R9092:Speg	UTSW	1	75422734	missense	probably benign	0.01
R9117:Speg	UTSW	1	75387800	missense	probably damaging	1.00
R9202:Speg	UTSW	1	75390993	missense	probably damaging	1.00
R9246:Speg	UTSW	1	75384854	missense	probably damaging	1.00
R9248:Speg	UTSW	1	75421776	missense	probably damaging	1.00
R9451:Speg	UTSW	1	75417733	missense	probably damaging	1.00
R9452:Speg	UTSW	1	75422508	missense	probably benign
R9475:Speg	UTSW	1	75388091	missense	probably damaging	1.00
R9476:Speg	UTSW	1	75401124	missense	probably damaging	0.99
R9510:Speg	UTSW	1	75401124	missense	probably damaging	0.99
R9519:Speg	UTSW	1	75415736	missense	probably damaging	1.00
R9528:Speg	UTSW	1	75387803	missense	possibly damaging	0.78
R9542:Speg	UTSW	1	75422782	missense	probably benign	0.08
R9553:Speg	UTSW	1	75418001	missense	probably benign	0.00
R9767:Speg	UTSW	1	75427181	missense	possibly damaging	0.78
R9768:Speg	UTSW	1	75418973	nonsense	probably null
R9800:Speg	UTSW	1	75422714	missense	probably benign	0.03
X0025:Speg	UTSW	1	75422457	missense	probably damaging	1.00
X0026:Speg	UTSW	1	75423475	missense	possibly damaging	0.88
Z1176:Speg	UTSW	1	75406594	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75427683	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75428381	missense	probably damaging	1.00
Z1177:Speg	UTSW	1	75430455	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTTATCGCTGAGAGCTGTGG -3'
(R):5'- GCGGGTAATATATGAGTGGTACATG -3'

Sequencing Primer
(F):5'- AACCGGGAACTCCTCTGTG -3'
(R):5'- AATATATGAGTGGTACATGTGTGGG -3'

Posted On

2018-06-22