Incidental Mutation 'R6612:Kdm5a'
ID523663
Institutional Source Beutler Lab
Gene Symbol Kdm5a
Ensembl Gene ENSMUSG00000030180
Gene Namelysine (K)-specific demethylase 5A
SynonymsJarid1a, Rbbp2, RBP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6612 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location120364124-120444574 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120430228 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1468 (I1468T)
Ref Sequence ENSEMBL: ENSMUSP00000005108 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005108]
Predicted Effect probably damaging
Transcript: ENSMUST00000005108
AA Change: I1468T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000005108
Gene: ENSMUSG00000030180
AA Change: I1468T

DomainStartEndE-ValueType
JmjN 18 59 4.06e-20 SMART
ARID 81 170 4.76e-35 SMART
BRIGHT 85 175 2.48e-31 SMART
PHD 295 341 1.16e-14 SMART
Blast:JmjC 384 436 2e-22 BLAST
JmjC 437 603 5.88e-73 SMART
low complexity region 638 651 N/A INTRINSIC
Pfam:zf-C5HC2 676 729 1.3e-21 PFAM
Pfam:PLU-1 740 1072 1.2e-104 PFAM
low complexity region 1091 1119 N/A INTRINSIC
PHD 1163 1216 1.37e-11 SMART
low complexity region 1269 1280 N/A INTRINSIC
low complexity region 1337 1351 N/A INTRINSIC
low complexity region 1403 1414 N/A INTRINSIC
low complexity region 1494 1512 N/A INTRINSIC
coiled coil region 1534 1579 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142791
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.4%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Jumonji, AT-rich interactive domain 1 (JARID1) histone demethylase protein family. The encoded protein plays a role in gene regulation through the histone code by specifically demethylating lysine 4 of histone H3. The encoded protein interacts with many other proteins, including retinoblastoma protein, and is implicated in the transcriptional regulation of Hox genes and cytokines. This gene may play a role in tumor progression. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body size, abnormal involuntary movement and quantitative changes in the hematopoietic stem cell and myeloid progenitor compartments, consistent with enhanced survival and increased cycling. Neonatalsurvival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,007 D320E possibly damaging Het
4930523C07Rik A C 1: 160,075,234 N25H probably damaging Het
Akr1c14 A T 13: 4,065,331 S87C probably benign Het
Arhgef37 T C 18: 61,494,881 T664A probably benign Het
Arsi A G 18: 60,912,456 T73A probably benign Het
Cacnb2 A T 2: 14,975,149 T274S probably benign Het
Cd244 A G 1: 171,574,104 T133A probably benign Het
Ciz1 T A 2: 32,377,311 S720T possibly damaging Het
Cxcr6 T A 9: 123,810,720 I262N probably damaging Het
Cyp2a4 T A 7: 26,308,647 F160I probably benign Het
Esrra T C 19: 6,911,852 T390A probably benign Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Gm17079 C A 14: 51,694,375 Q91H probably damaging Het
Gm17079 T A 14: 51,694,376 Q91L possibly damaging Het
Got1 A G 19: 43,504,803 S256P probably damaging Het
Gria4 C T 9: 4,472,206 V428I possibly damaging Het
Grin2b A G 6: 135,740,998 Y699H probably damaging Het
Hipk2 T C 6: 38,818,873 I154V probably benign Het
Hkdc1 T C 10: 62,395,441 E628G possibly damaging Het
Hmcn1 C G 1: 150,595,118 probably null Het
Hspbap1 T G 16: 35,801,591 L102W probably damaging Het
Iqcb1 G A 16: 36,871,661 probably benign Het
Itga7 A G 10: 128,948,993 Y763C possibly damaging Het
Itgb4 A T 11: 115,984,071 D418V probably benign Het
Jakmip2 T C 18: 43,557,367 D631G probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Kcnu1 A G 8: 25,918,316 I52V probably benign Het
Kmt2d A G 15: 98,845,858 probably benign Het
Mab21l3 A G 3: 101,818,645 V345A possibly damaging Het
March10 A T 11: 105,397,078 S133T probably damaging Het
Mccc1 T C 3: 35,993,930 S115G probably benign Het
Mchr1 G A 15: 81,237,870 V274M probably damaging Het
Mrgpra3 T A 7: 47,590,035 I48F probably benign Het
Myo9a T A 9: 59,827,196 F687Y probably damaging Het
Nfrkb T A 9: 31,397,006 L216* probably null Het
Nrxn3 A T 12: 89,813,332 probably benign Het
Olfr746 A T 14: 50,653,633 Y132F probably damaging Het
Olig2 T A 16: 91,226,881 M161K probably damaging Het
Pcdh15 T A 10: 74,185,378 N141K probably damaging Het
Pcdha4 T C 18: 36,954,978 V738A probably benign Het
Pdgfra T C 5: 75,167,842 S212P probably benign Het
Plk3 G A 4: 117,132,737 Q194* probably null Het
Ppp1r36 T C 12: 76,437,604 I216T possibly damaging Het
Ptprz1 T A 6: 23,052,082 N2303K probably damaging Het
Rab25 G A 3: 88,543,403 T117M probably damaging Het
Slc25a47 T C 12: 108,855,978 V231A probably benign Het
Slx4 G A 16: 3,985,276 H1225Y probably damaging Het
Snx13 C T 12: 35,106,759 A470V probably benign Het
Spa17 A G 9: 37,605,794 F101S probably benign Het
Ssh1 C T 5: 113,958,730 A217T probably benign Het
Synm G C 7: 67,733,516 T1466S probably damaging Het
Tbc1d19 A G 5: 53,809,845 E29G possibly damaging Het
Teddm2 T A 1: 153,850,445 T175S probably benign Het
Tet2 T A 3: 133,487,335 H446L possibly damaging Het
Tmem110 T A 14: 30,871,564 probably null Het
Tpm3-rs7 G T 14: 113,314,836 R54L probably benign Het
Ttc5 T A 14: 50,785,469 probably null Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Ush2a T C 1: 188,911,397 S4319P possibly damaging Het
Zbtb10 C A 3: 9,252,065 H312Q possibly damaging Het
Zfp462 A T 4: 55,012,324 probably null Het
Other mutations in Kdm5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Kdm5a APN 6 120385719 critical splice donor site probably null 0.00
IGL00706:Kdm5a APN 6 120406636 missense possibly damaging 0.44
IGL01361:Kdm5a APN 6 120399016 missense probably damaging 1.00
IGL01402:Kdm5a APN 6 120390679 nonsense probably null 0.00
IGL01924:Kdm5a APN 6 120394255 critical splice donor site probably null 0.00
IGL01935:Kdm5a APN 6 120408323 missense probably benign 0.02
IGL02165:Kdm5a APN 6 120415290 missense probably damaging 1.00
IGL02472:Kdm5a APN 6 120406730 splice site probably benign
IGL02506:Kdm5a APN 6 120432149 missense probably damaging 0.99
IGL02604:Kdm5a APN 6 120431980 missense probably benign
IGL02633:Kdm5a APN 6 120364719 missense probably damaging 1.00
IGL02876:Kdm5a APN 6 120390644 unclassified probably benign
IGL03009:Kdm5a APN 6 120430086 missense probably damaging 0.98
IGL03027:Kdm5a APN 6 120374990 splice site probably null
IGL03164:Kdm5a APN 6 120439019 missense probably damaging 1.00
IGL03236:Kdm5a APN 6 120438988 missense probably damaging 0.98
IGL03276:Kdm5a APN 6 120402708 splice site probably benign
Augmented UTSW 6 120430016 intron probably benign
calla_lily UTSW 6 120405022 missense probably damaging 1.00
crocus UTSW 6 120399038 missense probably null 0.98
Magnolia UTSW 6 120398978 missense probably damaging 0.99
Selbst UTSW 6 120388105 nonsense probably null
R0320:Kdm5a UTSW 6 120389620 missense probably benign 0.19
R0462:Kdm5a UTSW 6 120402600 missense probably damaging 1.00
R0601:Kdm5a UTSW 6 120402671 missense possibly damaging 0.76
R0628:Kdm5a UTSW 6 120415239 missense probably damaging 1.00
R1024:Kdm5a UTSW 6 120399038 missense probably null 0.98
R2013:Kdm5a UTSW 6 120431990 missense probably benign 0.09
R2015:Kdm5a UTSW 6 120431990 missense probably benign 0.09
R2061:Kdm5a UTSW 6 120381617 missense probably benign
R2188:Kdm5a UTSW 6 120406640 missense possibly damaging 0.59
R3923:Kdm5a UTSW 6 120381664 missense probably benign 0.01
R4013:Kdm5a UTSW 6 120394106 missense probably damaging 1.00
R4016:Kdm5a UTSW 6 120394106 missense probably damaging 1.00
R4017:Kdm5a UTSW 6 120394106 missense probably damaging 1.00
R4030:Kdm5a UTSW 6 120405113 nonsense probably null
R4646:Kdm5a UTSW 6 120374977 missense possibly damaging 0.55
R4737:Kdm5a UTSW 6 120406015 intron probably benign
R4779:Kdm5a UTSW 6 120369099 unclassified probably benign
R4836:Kdm5a UTSW 6 120412402 missense probably damaging 1.00
R5129:Kdm5a UTSW 6 120405022 missense probably damaging 1.00
R5182:Kdm5a UTSW 6 120388105 nonsense probably null
R5183:Kdm5a UTSW 6 120430016 intron probably benign
R5572:Kdm5a UTSW 6 120412375 missense possibly damaging 0.69
R6110:Kdm5a UTSW 6 120412306 missense probably damaging 1.00
R6132:Kdm5a UTSW 6 120374931 missense probably damaging 1.00
R6198:Kdm5a UTSW 6 120438997 missense probably benign 0.37
R6246:Kdm5a UTSW 6 120431910 missense probably damaging 0.97
R6336:Kdm5a UTSW 6 120398978 missense probably damaging 0.99
R6343:Kdm5a UTSW 6 120382933 missense probably benign 0.01
R6647:Kdm5a UTSW 6 120412461 missense probably benign 0.25
R7068:Kdm5a UTSW 6 120430215 missense probably benign 0.40
R7369:Kdm5a UTSW 6 120432004 missense possibly damaging 0.67
R7380:Kdm5a UTSW 6 120405918 missense probably benign 0.35
R7411:Kdm5a UTSW 6 120426815 missense probably damaging 1.00
R7521:Kdm5a UTSW 6 120432187 nonsense probably null
R7570:Kdm5a UTSW 6 120427842 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAGGTTCTAGCACTCCAAGAAAGC -3'
(R):5'- CCTTCCTTCTCTCTAGCAGAAATAG -3'

Sequencing Primer
(F):5'- TCCAAGAAAGCAGCCTCGG -3'
(R):5'- TTTTTGCTTAAATGAGAGAACATGAC -3'
Posted On2018-06-22