Incidental Mutation 'R6505:Dpp10'
ID523664
Institutional Source Beutler Lab
Gene Symbol Dpp10
Ensembl Gene ENSMUSG00000036815
Gene Namedipeptidylpeptidase 10
Synonyms6430601K09Rik, DPRP3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6505 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location123321471-124045559 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 123336851 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 747 (I747M)
Ref Sequence ENSEMBL: ENSMUSP00000108225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112603] [ENSMUST00000112606]
Predicted Effect probably damaging
Transcript: ENSMUST00000112603
AA Change: I736M

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108222
Gene: ENSMUSG00000036815
AA Change: I736M

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:DPPIV_N 83 450 4.9e-118 PFAM
Pfam:Peptidase_S9 530 734 6.4e-47 PFAM
Pfam:DLH 556 711 1.4e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112606
AA Change: I747M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108225
Gene: ENSMUSG00000036815
AA Change: I747M

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 64 79 N/A INTRINSIC
Pfam:DPPIV_N 137 504 4.4e-115 PFAM
Pfam:Peptidase_S9 584 788 8.6e-48 PFAM
Pfam:DLH 604 774 1.1e-7 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type II membrane protein that is a member of the S9B family in clan SC of the serine proteases. This protein has no detectable protease activity, most likely due to the absence of the conserved serine residue normally present in the catalytic domain of serine proteases. However, it does bind specific voltage-gated potassium channels and alters their expression and biophysical properties. Mutations in this gene have been associated with asthma. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,001,940 I424L probably benign Het
2610028H24Rik C T 10: 76,449,281 A8V probably benign Het
Ago1 G A 4: 126,463,835 P16S probably benign Het
Ak5 C T 3: 152,481,669 E394K probably benign Het
Aldh7a1 T C 18: 56,526,996 Y498C probably damaging Het
Alox12 T A 11: 70,250,204 D335V probably damaging Het
Alx4 A T 2: 93,668,559 Y212F probably damaging Het
Asb16 A G 11: 102,276,477 E223G probably damaging Het
Atg9b C T 5: 24,390,577 V235M probably damaging Het
BB014433 A G 8: 15,042,304 V183A probably benign Het
Brca1 T A 11: 101,523,541 M1256L probably benign Het
Bst1 A G 5: 43,820,590 I94V probably benign Het
C3ar1 A G 6: 122,850,640 L206P probably benign Het
Cabs1 T A 5: 87,980,663 M391K possibly damaging Het
Cars C T 7: 143,565,007 R599Q probably damaging Het
Ccdc190 T A 1: 169,933,023 Y73* probably null Het
Cd177 A C 7: 24,744,246 L809W probably benign Het
Cemip C A 7: 83,951,597 G939* probably null Het
Clca3b T A 3: 144,825,259 I777F probably benign Het
Cma2 T C 14: 55,973,779 I176T probably damaging Het
Col12a1 T A 9: 79,647,605 T2064S probably damaging Het
Csf1r A G 18: 61,129,733 N860S probably damaging Het
Dab1 T A 4: 104,512,264 C3S probably benign Het
Dennd4b A G 3: 90,267,611 E50G probably damaging Het
Dis3l A T 9: 64,307,513 S925T probably benign Het
Disp1 T C 1: 183,086,512 N1448S probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ephx4 A T 5: 107,403,656 K36* probably null Het
Fam135a C T 1: 24,014,872 V1195I probably damaging Het
Fap A T 2: 62,546,603 Y234* probably null Het
Fem1c A T 18: 46,505,875 N353K possibly damaging Het
Furin C A 7: 80,393,617 R282L probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5930 A G 14: 44,331,371 *265Q probably null Het
Hcrtr1 T A 4: 130,137,586 T15S probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Il18r1 A T 1: 40,489,707 I304L probably benign Het
Ino80 A T 2: 119,451,441 Y185N probably damaging Het
Itgb2 G A 10: 77,559,673 C536Y probably damaging Het
Ivns1abp T C 1: 151,360,993 M435T probably benign Het
Kcnh4 T C 11: 100,757,085 N151D probably benign Het
Lama3 T C 18: 12,495,348 M1499T probably benign Het
Lamb1 A T 12: 31,323,462 T1397S possibly damaging Het
Leng1 G A 7: 3,661,212 R239* probably null Het
Map2k4 A T 11: 65,693,529 N309K possibly damaging Het
Mcm3 A G 1: 20,803,544 F784S probably damaging Het
Mrgpra9 T A 7: 47,235,136 N260I probably benign Het
Mrnip C A 11: 50,199,852 T281N possibly damaging Het
Myo9b A G 8: 71,355,857 T1715A possibly damaging Het
Nectin3 A G 16: 46,448,821 I406T possibly damaging Het
Neto1 A G 18: 86,498,574 T339A possibly damaging Het
Ntn1 T C 11: 68,213,199 D541G probably damaging Het
Nuak2 C A 1: 132,316,394 H55Q probably damaging Het
Nufip2 A G 11: 77,691,613 T118A probably benign Het
Olfr1126 T A 2: 87,457,927 V254E probably damaging Het
Olfr1155 A T 2: 87,943,174 Y151* probably null Het
Olfr19 A T 16: 16,673,920 D20E probably benign Het
Olfr213 C T 6: 116,540,600 T49M probably benign Het
Olfr266 T G 3: 106,822,322 N79T possibly damaging Het
Olfr483 T C 7: 108,103,567 V86A probably benign Het
Olfr596 C A 7: 103,309,793 A24D probably benign Het
Olfr609 T A 7: 103,492,651 T76S probably damaging Het
Olfr847 T C 9: 19,374,941 *313W probably null Het
Pcdhb5 T A 18: 37,320,880 H104Q probably benign Het
Phf11a T C 14: 59,277,537 R232G probably damaging Het
Pik3r5 C T 11: 68,492,789 T478I probably benign Het
Prkacb T A 3: 146,732,646 E380V probably damaging Het
Prl7c1 G T 13: 27,773,793 D221E probably damaging Het
Prr11 T A 11: 87,106,124 K5* probably null Het
Prrc2b G A 2: 32,222,320 G1932D probably damaging Het
Rexo1 A T 10: 80,543,011 Y1064N possibly damaging Het
Rnf182 C T 13: 43,668,671 Q233* probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sash1 C G 10: 8,729,527 G1033A probably benign Het
Sncaip C A 18: 52,906,537 S189* probably null Het
Sorl1 T C 9: 42,071,234 Y350C probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Speg C A 1: 75,429,523 D3091E possibly damaging Het
Sucnr1 A T 3: 60,086,723 D224V probably benign Het
Tg G A 15: 66,759,558 A559T probably damaging Het
Tmem132d A G 5: 127,784,438 I873T probably benign Het
Tmem229a C T 6: 24,954,921 C278Y probably damaging Het
Togaram1 T C 12: 64,966,590 I205T possibly damaging Het
Usp19 T A 9: 108,496,883 L713Q probably damaging Het
Vsig10 A G 5: 117,351,759 D530G possibly damaging Het
Zfp106 A G 2: 120,534,502 S475P probably damaging Het
Other mutations in Dpp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01592:Dpp10 APN 1 123334370 missense probably damaging 1.00
IGL01618:Dpp10 APN 1 123367867 missense probably benign
IGL02101:Dpp10 APN 1 123411826 missense probably damaging 1.00
IGL02284:Dpp10 APN 1 124045366 splice site probably benign
IGL02324:Dpp10 APN 1 123367802 missense probably benign 0.02
IGL02391:Dpp10 APN 1 123650358 missense probably damaging 0.98
IGL02458:Dpp10 APN 1 123341689 missense probably benign 0.01
IGL02469:Dpp10 APN 1 123411803 missense probably benign 0.01
IGL02501:Dpp10 APN 1 123686270 missense possibly damaging 0.93
IGL02522:Dpp10 APN 1 123423652 missense probably benign 0.24
IGL02672:Dpp10 APN 1 123376647 missense probably benign 0.45
IGL03034:Dpp10 APN 1 123341619 missense probably damaging 1.00
PIT1430001:Dpp10 UTSW 1 123341182 splice site probably benign
R0104:Dpp10 UTSW 1 123367843 missense probably benign 0.00
R0114:Dpp10 UTSW 1 123486092 missense probably benign 0.07
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0242:Dpp10 UTSW 1 123398546 missense possibly damaging 0.56
R0682:Dpp10 UTSW 1 123905125 missense probably damaging 0.98
R0815:Dpp10 UTSW 1 123432929 critical splice donor site probably null
R1549:Dpp10 UTSW 1 123341380 critical splice acceptor site probably null
R1742:Dpp10 UTSW 1 123445206 missense probably damaging 1.00
R1859:Dpp10 UTSW 1 123353604 missense possibly damaging 0.47
R1991:Dpp10 UTSW 1 123905106 missense probably null 1.00
R1992:Dpp10 UTSW 1 123905106 missense probably null 1.00
R2079:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
R2882:Dpp10 UTSW 1 123445203 missense probably damaging 1.00
R2974:Dpp10 UTSW 1 123411705 splice site probably benign
R3827:Dpp10 UTSW 1 123411790 missense possibly damaging 0.56
R3852:Dpp10 UTSW 1 123485924 nonsense probably null
R3876:Dpp10 UTSW 1 123353487 missense probably damaging 0.98
R3899:Dpp10 UTSW 1 123353557 missense probably damaging 1.00
R4735:Dpp10 UTSW 1 123398627 missense probably benign 0.15
R4922:Dpp10 UTSW 1 123378153 missense probably benign 0.44
R5457:Dpp10 UTSW 1 123411810 missense possibly damaging 0.51
R5599:Dpp10 UTSW 1 123905076 missense probably damaging 0.99
R5913:Dpp10 UTSW 1 123384289 missense probably damaging 1.00
R5979:Dpp10 UTSW 1 123384283 critical splice donor site probably null
R6378:Dpp10 UTSW 1 123411739 missense probably damaging 1.00
R6429:Dpp10 UTSW 1 123367601 missense possibly damaging 0.72
R6776:Dpp10 UTSW 1 123367656 nonsense probably null
R6894:Dpp10 UTSW 1 123336864 missense probably damaging 1.00
R6951:Dpp10 UTSW 1 123341650 missense possibly damaging 0.93
R7182:Dpp10 UTSW 1 123341151 missense probably benign 0.15
R7246:Dpp10 UTSW 1 123334377 missense probably damaging 1.00
R7297:Dpp10 UTSW 1 123353428 nonsense probably null
R7375:Dpp10 UTSW 1 123367795 missense probably benign
R7387:Dpp10 UTSW 1 123341140 missense probably benign 0.01
R7661:Dpp10 UTSW 1 123384952 missense probably damaging 1.00
R8065:Dpp10 UTSW 1 123352660 missense probably benign
R8067:Dpp10 UTSW 1 123352660 missense probably benign
R8260:Dpp10 UTSW 1 123686295 missense probably benign
R8324:Dpp10 UTSW 1 123854172 missense probably benign 0.02
R8373:Dpp10 UTSW 1 123854229 missense possibly damaging 0.94
R8434:Dpp10 UTSW 1 123433010 missense probably damaging 1.00
X0019:Dpp10 UTSW 1 123398585 missense possibly damaging 0.88
X0020:Dpp10 UTSW 1 123398582 missense probably benign 0.36
X0021:Dpp10 UTSW 1 123432992 missense probably damaging 1.00
X0024:Dpp10 UTSW 1 123384286 missense probably damaging 1.00
Z1176:Dpp10 UTSW 1 123353440 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACACATTCATGCACATGTGAGTG -3'
(R):5'- CCAGCAGGTCTTTCTTCCAAG -3'

Sequencing Primer
(F):5'- GTATGATACTTCCTTGCCACAGAGG -3'
(R):5'- CCAAGTATACAATGTGTGTAGAGCAC -3'
Posted On2018-06-22