Mutagenetix > Incidental Mutation

Incidental Mutation 'R6612:Grin2b'

523665

Institutional Source

Beutler Lab

Gene Symbol

Grin2b

Ensembl Gene

ENSMUSG00000030209

Gene Name

glutamate receptor, ionotropic, NMDA2B (epsilon 2)

Synonyms

GluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6612 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

135713233-136173511 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 135740998 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 699 (Y699H)

Ref Sequence

ENSEMBL: ENSMUSP00000107536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000053880
AA Change: Y699H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: Y699H

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	106	306	8.6e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	4.8e-270	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000111905
AA Change: Y699H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: Y699H

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:ANF_receptor	56	307	4.2e-10	PFAM
PBPe	431	799	1.06e-67	SMART
Lig_chan-Glu_bd	440	503	1.82e-22	SMART
Pfam:NMDAR2_C	840	1482	2.1e-245	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136027

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158638

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.4%

Validation Efficiency

95% (59/62)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,692,007	D320E	possibly damaging	Het
4930523C07Rik	A	C	1: 160,075,234	N25H	probably damaging	Het
Akr1c14	A	T	13: 4,065,331	S87C	probably benign	Het
Arhgef37	T	C	18: 61,494,881	T664A	probably benign	Het
Arsi	A	G	18: 60,912,456	T73A	probably benign	Het
Cacnb2	A	T	2: 14,975,149	T274S	probably benign	Het
Cd244	A	G	1: 171,574,104	T133A	probably benign	Het
Ciz1	T	A	2: 32,377,311	S720T	possibly damaging	Het
Cxcr6	T	A	9: 123,810,720	I262N	probably damaging	Het
Cyp2a4	T	A	7: 26,308,647	F160I	probably benign	Het
Esrra	T	C	19: 6,911,852	T390A	probably benign	Het
Fopnl	TTGTG	TTG	16: 14,300,145		probably null	Het
Gm17079	C	A	14: 51,694,375	Q91H	probably damaging	Het
Gm17079	T	A	14: 51,694,376	Q91L	possibly damaging	Het
Got1	A	G	19: 43,504,803	S256P	probably damaging	Het
Gria4	C	T	9: 4,472,206	V428I	possibly damaging	Het
Hipk2	T	C	6: 38,818,873	I154V	probably benign	Het
Hkdc1	T	C	10: 62,395,441	E628G	possibly damaging	Het
Hmcn1	C	G	1: 150,595,118		probably null	Het
Hspbap1	T	G	16: 35,801,591	L102W	probably damaging	Het
Iqcb1	G	A	16: 36,871,661		probably benign	Het
Itga7	A	G	10: 128,948,993	Y763C	possibly damaging	Het
Itgb4	A	T	11: 115,984,071	D418V	probably benign	Het
Jakmip2	T	C	18: 43,557,367	D631G	probably damaging	Het
Kcnc2	G	C	10: 112,271,856	G51R	probably benign	Het
Kcnu1	A	G	8: 25,918,316	I52V	probably benign	Het
Kdm5a	T	C	6: 120,430,228	I1468T	probably damaging	Het
Kmt2d	A	G	15: 98,845,858		probably benign	Het
Mab21l3	A	G	3: 101,818,645	V345A	possibly damaging	Het
March10	A	T	11: 105,397,078	S133T	probably damaging	Het
Mccc1	T	C	3: 35,993,930	S115G	probably benign	Het
Mchr1	G	A	15: 81,237,870	V274M	probably damaging	Het
Mrgpra3	T	A	7: 47,590,035	I48F	probably benign	Het
Myo9a	T	A	9: 59,827,196	F687Y	probably damaging	Het
Nfrkb	T	A	9: 31,397,006	L216*	probably null	Het
Nrxn3	A	T	12: 89,813,332		probably benign	Het
Olfr746	A	T	14: 50,653,633	Y132F	probably damaging	Het
Olig2	T	A	16: 91,226,881	M161K	probably damaging	Het
Pcdh15	T	A	10: 74,185,378	N141K	probably damaging	Het
Pcdha4	T	C	18: 36,954,978	V738A	probably benign	Het
Pdgfra	T	C	5: 75,167,842	S212P	probably benign	Het
Plk3	G	A	4: 117,132,737	Q194*	probably null	Het
Ppp1r36	T	C	12: 76,437,604	I216T	possibly damaging	Het
Ptprz1	T	A	6: 23,052,082	N2303K	probably damaging	Het
Rab25	G	A	3: 88,543,403	T117M	probably damaging	Het
Slc25a47	T	C	12: 108,855,978	V231A	probably benign	Het
Slx4	G	A	16: 3,985,276	H1225Y	probably damaging	Het
Snx13	C	T	12: 35,106,759	A470V	probably benign	Het
Spa17	A	G	9: 37,605,794	F101S	probably benign	Het
Ssh1	C	T	5: 113,958,730	A217T	probably benign	Het
Synm	G	C	7: 67,733,516	T1466S	probably damaging	Het
Tbc1d19	A	G	5: 53,809,845	E29G	possibly damaging	Het
Teddm2	T	A	1: 153,850,445	T175S	probably benign	Het
Tet2	T	A	3: 133,487,335	H446L	possibly damaging	Het
Tmem110	T	A	14: 30,871,564		probably null	Het
Tpm3-rs7	G	T	14: 113,314,836	R54L	probably benign	Het
Ttc5	T	A	14: 50,785,469		probably null	Het
Tyk2	G	T	9: 21,108,016	Q1014K	probably benign	Het
Ush2a	T	C	1: 188,911,397	S4319P	possibly damaging	Het
Zbtb10	C	A	3: 9,252,065	H312Q	possibly damaging	Het
Zfp462	A	T	4: 55,012,324		probably null	Het

Other mutations in Grin2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00494:Grin2b	APN	6	135736331	missense	possibly damaging	0.55
IGL00835:Grin2b	APN	6	135733570	missense	probably damaging	1.00
IGL01401:Grin2b	APN	6	135736363	missense	probably damaging	1.00
IGL01523:Grin2b	APN	6	136044265	missense	probably null	0.99
IGL01719:Grin2b	APN	6	135733381	missense	probably damaging	0.97
IGL01907:Grin2b	APN	6	135733740	missense	probably damaging	1.00
IGL01996:Grin2b	APN	6	135732586	missense	probably damaging	1.00
IGL02309:Grin2b	APN	6	135736472	missense	probably damaging	1.00
IGL02312:Grin2b	APN	6	135739090	missense	probably damaging	1.00
IGL02409:Grin2b	APN	6	136043908	missense	possibly damaging	0.89
IGL02527:Grin2b	APN	6	135923391	missense	probably damaging	1.00
IGL02535:Grin2b	APN	6	135779369	missense	possibly damaging	0.70
IGL02570:Grin2b	APN	6	135922998	missense	probably damaging	1.00
IGL02702:Grin2b	APN	6	135739132	missense	probably damaging	0.99
IGL03001:Grin2b	APN	6	135739115	missense	probably damaging	1.00
IGL03274:Grin2b	APN	6	135780255	missense	possibly damaging	0.90
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0055:Grin2b	UTSW	6	135923203	missense	probably benign
R0164:Grin2b	UTSW	6	135778648	splice site	probably benign
R0194:Grin2b	UTSW	6	135779305	missense	probably damaging	1.00
R0594:Grin2b	UTSW	6	135733929	missense	probably damaging	1.00
R1434:Grin2b	UTSW	6	135843195	missense	probably benign	0.04
R1928:Grin2b	UTSW	6	136044046	missense	probably damaging	1.00
R1942:Grin2b	UTSW	6	135732732	missense	possibly damaging	0.93
R1996:Grin2b	UTSW	6	136044211	missense	possibly damaging	0.52
R2002:Grin2b	UTSW	6	135733245	missense	probably damaging	1.00
R2020:Grin2b	UTSW	6	135733896	missense	probably benign	0.12
R2103:Grin2b	UTSW	6	135780140	missense	probably benign	0.02
R2127:Grin2b	UTSW	6	135778700	missense	probably benign	0.03
R2495:Grin2b	UTSW	6	135733182	missense	probably damaging	1.00
R2656:Grin2b	UTSW	6	135733429	missense	probably damaging	1.00
R2847:Grin2b	UTSW	6	135740953	missense	probably damaging	1.00
R2866:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R2867:Grin2b	UTSW	6	135733639	missense	probably damaging	1.00
R3196:Grin2b	UTSW	6	135732455	small deletion	probably benign
R3418:Grin2b	UTSW	6	135843110	missense	probably benign	0.02
R3808:Grin2b	UTSW	6	135923271	missense	probably damaging	0.99
R4028:Grin2b	UTSW	6	135736435	missense	probably damaging	1.00
R4602:Grin2b	UTSW	6	135778741	missense	probably damaging	1.00
R4624:Grin2b	UTSW	6	135733825	missense	probably damaging	0.99
R4677:Grin2b	UTSW	6	135774872	missense	probably benign	0.13
R4744:Grin2b	UTSW	6	135778699	missense	probably damaging	1.00
R5020:Grin2b	UTSW	6	135733407	missense	probably benign	0.01
R5051:Grin2b	UTSW	6	135779395	missense	possibly damaging	0.84
R5105:Grin2b	UTSW	6	135732441	missense	probably benign	0.03
R5125:Grin2b	UTSW	6	135923299	missense	possibly damaging	0.89
R5146:Grin2b	UTSW	6	135779342	missense	probably damaging	1.00
R5318:Grin2b	UTSW	6	135733918	missense	probably damaging	0.99
R5349:Grin2b	UTSW	6	136044283	missense	possibly damaging	0.93
R5426:Grin2b	UTSW	6	135732368	missense	probably damaging	1.00
R5438:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5439:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5440:Grin2b	UTSW	6	135736306	missense	probably damaging	1.00
R5530:Grin2b	UTSW	6	135733723	missense	probably benign	0.00
R5603:Grin2b	UTSW	6	135923397	missense	probably damaging	1.00
R5657:Grin2b	UTSW	6	135733087	missense	possibly damaging	0.48
R5788:Grin2b	UTSW	6	135740964	missense	probably benign	0.24
R5941:Grin2b	UTSW	6	135736373	missense	probably damaging	0.99
R6057:Grin2b	UTSW	6	135733944	missense	possibly damaging	0.84
R6137:Grin2b	UTSW	6	135923458	missense	possibly damaging	0.89
R6216:Grin2b	UTSW	6	135772399	missense	probably damaging	1.00
R6309:Grin2b	UTSW	6	135733027	missense	probably benign	0.00
R6316:Grin2b	UTSW	6	135780279	missense	probably benign	0.00
R6419:Grin2b	UTSW	6	135740967	missense	probably damaging	1.00
R6551:Grin2b	UTSW	6	135733344	missense	probably damaging	1.00
R6616:Grin2b	UTSW	6	135732551	missense	probably benign
R6647:Grin2b	UTSW	6	135733110	missense	probably damaging	1.00
R6806:Grin2b	UTSW	6	135774828	missense	possibly damaging	0.84
R6976:Grin2b	UTSW	6	135780200	missense	probably benign
R7033:Grin2b	UTSW	6	135923038	missense	probably damaging	1.00
R7058:Grin2b	UTSW	6	135780306	missense	probably damaging	0.97
R7144:Grin2b	UTSW	6	135733476	missense	possibly damaging	0.50
R7190:Grin2b	UTSW	6	135732948	missense	possibly damaging	0.46
R7238:Grin2b	UTSW	6	135780251	missense	probably damaging	0.97
R7453:Grin2b	UTSW	6	135740949	missense	possibly damaging	0.56
R7553:Grin2b	UTSW	6	135772396	missense	possibly damaging	0.88
R7585:Grin2b	UTSW	6	135779303	missense	probably damaging	0.99
R7615:Grin2b	UTSW	6	135923364	missense	probably damaging	1.00
R7632:Grin2b	UTSW	6	135732555	missense	probably benign	0.02
R7779:Grin2b	UTSW	6	135778794	nonsense	probably null
R8058:Grin2b	UTSW	6	135733227	missense	probably damaging	1.00
R8084:Grin2b	UTSW	6	135733488	missense	probably benign	0.03
R8145:Grin2b	UTSW	6	135732499	missense	probably benign	0.01
R8308:Grin2b	UTSW	6	135923076	missense	probably damaging	0.99
R8357:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8379:Grin2b	UTSW	6	135922969	missense	probably damaging	1.00
R8429:Grin2b	UTSW	6	135733916	missense	probably damaging	1.00
R8457:Grin2b	UTSW	6	135732199	missense	probably benign	0.00
R8746:Grin2b	UTSW	6	135922987	missense	probably benign	0.02
R8925:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8927:Grin2b	UTSW	6	135772341	missense	probably damaging	0.97
R8963:Grin2b	UTSW	6	136044009	missense	probably damaging	1.00
R9075:Grin2b	UTSW	6	135732511	frame shift	probably null
R9076:Grin2b	UTSW	6	135732511	frame shift	probably null
R9172:Grin2b	UTSW	6	135779257	missense	possibly damaging	0.84
R9520:Grin2b	UTSW	6	135733401	missense	probably damaging	1.00
R9740:Grin2b	UTSW	6	135922870	critical splice donor site	probably null
RF001:Grin2b	UTSW	6	136044240	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCCATCAAATTTGACTTGGAAACAG -3'
(R):5'- TTACTGCTCCTGAGTGAGGG -3'

Sequencing Primer
(F):5'- AATTTGACTTGGAAACAGTCTTTTG -3'
(R):5'- CTCCTGAGTGAGGGCTAATG -3'

Posted On

2018-06-22