Incidental Mutation 'R6612:Grin2b'
ID 523665
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Name glutamate receptor, ionotropic, NMDA2B (epsilon 2)
Synonyms GluRepsilon2, GluN2B, NR2B, NMDAR2B, Nmdar2b
MMRRC Submission 044735-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6612 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 135690231-136150509 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 135717996 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 699 (Y699H)
Ref Sequence ENSEMBL: ENSMUSP00000107536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000053880
AA Change: Y699H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: Y699H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111905
AA Change: Y699H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: Y699H

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158638
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.4%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik A C 1: 159,902,804 (GRCm39) N25H probably damaging Het
Akr1c14 A T 13: 4,115,331 (GRCm39) S87C probably benign Het
Arhgef37 T C 18: 61,627,952 (GRCm39) T664A probably benign Het
Arsi A G 18: 61,045,528 (GRCm39) T73A probably benign Het
Cacnb2 A T 2: 14,979,960 (GRCm39) T274S probably benign Het
Cd244a A G 1: 171,401,672 (GRCm39) T133A probably benign Het
Cep20 TTGTG TTG 16: 14,118,009 (GRCm39) probably null Het
Ciz1 T A 2: 32,267,323 (GRCm39) S720T possibly damaging Het
Cxcr6 T A 9: 123,639,785 (GRCm39) I262N probably damaging Het
Cyp2a4 T A 7: 26,008,072 (GRCm39) F160I probably benign Het
Esrra T C 19: 6,889,220 (GRCm39) T390A probably benign Het
Gm17079 T A 14: 51,931,833 (GRCm39) Q91L possibly damaging Het
Gm17079 C A 14: 51,931,832 (GRCm39) Q91H probably damaging Het
Got1 A G 19: 43,493,242 (GRCm39) S256P probably damaging Het
Gria4 C T 9: 4,472,206 (GRCm39) V428I possibly damaging Het
Hipk2 T C 6: 38,795,808 (GRCm39) I154V probably benign Het
Hkdc1 T C 10: 62,231,220 (GRCm39) E628G possibly damaging Het
Hmcn1 C G 1: 150,470,869 (GRCm39) probably null Het
Hspbap1 T G 16: 35,621,961 (GRCm39) L102W probably damaging Het
Iqcb1 G A 16: 36,692,023 (GRCm39) probably benign Het
Itga7 A G 10: 128,784,862 (GRCm39) Y763C possibly damaging Het
Itgb4 A T 11: 115,874,897 (GRCm39) D418V probably benign Het
Jakmip2 T C 18: 43,690,432 (GRCm39) D631G probably damaging Het
Kcnc2 G C 10: 112,107,761 (GRCm39) G51R probably benign Het
Kcnu1 A G 8: 26,408,344 (GRCm39) I52V probably benign Het
Kdm5a T C 6: 120,407,189 (GRCm39) I1468T probably damaging Het
Kmt2d A G 15: 98,743,739 (GRCm39) probably benign Het
Mab21l3 A G 3: 101,725,961 (GRCm39) V345A possibly damaging Het
Marchf10 A T 11: 105,287,904 (GRCm39) S133T probably damaging Het
Mccc1 T C 3: 36,048,079 (GRCm39) S115G probably benign Het
Mchr1 G A 15: 81,122,071 (GRCm39) V274M probably damaging Het
Mrgpra3 T A 7: 47,239,783 (GRCm39) I48F probably benign Het
Myo9a T A 9: 59,734,479 (GRCm39) F687Y probably damaging Het
Nfrkb T A 9: 31,308,302 (GRCm39) L216* probably null Het
Nrxn3 A T 12: 89,780,102 (GRCm39) probably benign Het
Olig2 T A 16: 91,023,769 (GRCm39) M161K probably damaging Het
Or11h7 A T 14: 50,891,090 (GRCm39) Y132F probably damaging Het
Pcdh15 T A 10: 74,021,210 (GRCm39) N141K probably damaging Het
Pcdha4 T C 18: 37,088,031 (GRCm39) V738A probably benign Het
Pdgfra T C 5: 75,328,503 (GRCm39) S212P probably benign Het
Plk3 G A 4: 116,989,934 (GRCm39) Q194* probably null Het
Ppp1r36 T C 12: 76,484,378 (GRCm39) I216T possibly damaging Het
Ptprz1 T A 6: 23,052,081 (GRCm39) N2303K probably damaging Het
Rab25 G A 3: 88,450,710 (GRCm39) T117M probably damaging Het
Relch T A 1: 105,619,732 (GRCm39) D320E possibly damaging Het
Slc25a47 T C 12: 108,821,904 (GRCm39) V231A probably benign Het
Slx4 G A 16: 3,803,140 (GRCm39) H1225Y probably damaging Het
Snx13 C T 12: 35,156,758 (GRCm39) A470V probably benign Het
Spa17 A G 9: 37,517,090 (GRCm39) F101S probably benign Het
Ssh1 C T 5: 114,096,791 (GRCm39) A217T probably benign Het
Stimate T A 14: 30,593,521 (GRCm39) probably null Het
Synm G C 7: 67,383,264 (GRCm39) T1466S probably damaging Het
Tbc1d19 A G 5: 53,967,187 (GRCm39) E29G possibly damaging Het
Teddm2 T A 1: 153,726,191 (GRCm39) T175S probably benign Het
Tet2 T A 3: 133,193,096 (GRCm39) H446L possibly damaging Het
Tpm3-rs7 G T 14: 113,552,268 (GRCm39) R54L probably benign Het
Ttc5 T A 14: 51,022,926 (GRCm39) probably null Het
Tyk2 G T 9: 21,019,312 (GRCm39) Q1014K probably benign Het
Ush2a T C 1: 188,643,594 (GRCm39) S4319P possibly damaging Het
Zbtb10 C A 3: 9,317,125 (GRCm39) H312Q possibly damaging Het
Zfp462 A T 4: 55,012,324 (GRCm39) probably null Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135,713,329 (GRCm39) missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135,710,568 (GRCm39) missense probably damaging 1.00
IGL01401:Grin2b APN 6 135,713,361 (GRCm39) missense probably damaging 1.00
IGL01523:Grin2b APN 6 136,021,263 (GRCm39) missense probably null 0.99
IGL01719:Grin2b APN 6 135,710,379 (GRCm39) missense probably damaging 0.97
IGL01907:Grin2b APN 6 135,710,738 (GRCm39) missense probably damaging 1.00
IGL01996:Grin2b APN 6 135,709,584 (GRCm39) missense probably damaging 1.00
IGL02309:Grin2b APN 6 135,713,470 (GRCm39) missense probably damaging 1.00
IGL02312:Grin2b APN 6 135,716,088 (GRCm39) missense probably damaging 1.00
IGL02409:Grin2b APN 6 136,020,906 (GRCm39) missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135,900,389 (GRCm39) missense probably damaging 1.00
IGL02535:Grin2b APN 6 135,756,367 (GRCm39) missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135,899,996 (GRCm39) missense probably damaging 1.00
IGL02702:Grin2b APN 6 135,716,130 (GRCm39) missense probably damaging 0.99
IGL03001:Grin2b APN 6 135,716,113 (GRCm39) missense probably damaging 1.00
IGL03274:Grin2b APN 6 135,757,253 (GRCm39) missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135,900,201 (GRCm39) missense probably benign
R0055:Grin2b UTSW 6 135,900,201 (GRCm39) missense probably benign
R0164:Grin2b UTSW 6 135,755,646 (GRCm39) splice site probably benign
R0194:Grin2b UTSW 6 135,756,303 (GRCm39) missense probably damaging 1.00
R0594:Grin2b UTSW 6 135,710,927 (GRCm39) missense probably damaging 1.00
R1434:Grin2b UTSW 6 135,820,193 (GRCm39) missense probably benign 0.04
R1928:Grin2b UTSW 6 136,021,044 (GRCm39) missense probably damaging 1.00
R1942:Grin2b UTSW 6 135,709,730 (GRCm39) missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136,021,209 (GRCm39) missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135,710,243 (GRCm39) missense probably damaging 1.00
R2020:Grin2b UTSW 6 135,710,894 (GRCm39) missense probably benign 0.12
R2103:Grin2b UTSW 6 135,757,138 (GRCm39) missense probably benign 0.02
R2127:Grin2b UTSW 6 135,755,698 (GRCm39) missense probably benign 0.03
R2495:Grin2b UTSW 6 135,710,180 (GRCm39) missense probably damaging 1.00
R2656:Grin2b UTSW 6 135,710,427 (GRCm39) missense probably damaging 1.00
R2847:Grin2b UTSW 6 135,717,951 (GRCm39) missense probably damaging 1.00
R2866:Grin2b UTSW 6 135,710,637 (GRCm39) missense probably damaging 1.00
R2867:Grin2b UTSW 6 135,710,637 (GRCm39) missense probably damaging 1.00
R2867:Grin2b UTSW 6 135,710,637 (GRCm39) missense probably damaging 1.00
R3196:Grin2b UTSW 6 135,709,453 (GRCm39) small deletion probably benign
R3418:Grin2b UTSW 6 135,820,108 (GRCm39) missense probably benign 0.02
R3808:Grin2b UTSW 6 135,900,269 (GRCm39) missense probably damaging 0.99
R4028:Grin2b UTSW 6 135,713,433 (GRCm39) missense probably damaging 1.00
R4602:Grin2b UTSW 6 135,755,739 (GRCm39) missense probably damaging 1.00
R4624:Grin2b UTSW 6 135,710,823 (GRCm39) missense probably damaging 0.99
R4677:Grin2b UTSW 6 135,751,870 (GRCm39) missense probably benign 0.13
R4744:Grin2b UTSW 6 135,755,697 (GRCm39) missense probably damaging 1.00
R5020:Grin2b UTSW 6 135,710,405 (GRCm39) missense probably benign 0.01
R5051:Grin2b UTSW 6 135,756,393 (GRCm39) missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135,709,439 (GRCm39) missense probably benign 0.03
R5125:Grin2b UTSW 6 135,900,297 (GRCm39) missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135,756,340 (GRCm39) missense probably damaging 1.00
R5318:Grin2b UTSW 6 135,710,916 (GRCm39) missense probably damaging 0.99
R5349:Grin2b UTSW 6 136,021,281 (GRCm39) missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135,709,366 (GRCm39) missense probably damaging 1.00
R5438:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5439:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5440:Grin2b UTSW 6 135,713,304 (GRCm39) missense probably damaging 1.00
R5530:Grin2b UTSW 6 135,710,721 (GRCm39) missense probably benign 0.00
R5603:Grin2b UTSW 6 135,900,395 (GRCm39) missense probably damaging 1.00
R5657:Grin2b UTSW 6 135,710,085 (GRCm39) missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135,717,962 (GRCm39) missense probably benign 0.24
R5941:Grin2b UTSW 6 135,713,371 (GRCm39) missense probably damaging 0.99
R6057:Grin2b UTSW 6 135,710,942 (GRCm39) missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135,900,456 (GRCm39) missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135,749,397 (GRCm39) missense probably damaging 1.00
R6309:Grin2b UTSW 6 135,710,025 (GRCm39) missense probably benign 0.00
R6316:Grin2b UTSW 6 135,757,277 (GRCm39) missense probably benign 0.00
R6419:Grin2b UTSW 6 135,717,965 (GRCm39) missense probably damaging 1.00
R6551:Grin2b UTSW 6 135,710,342 (GRCm39) missense probably damaging 1.00
R6616:Grin2b UTSW 6 135,709,549 (GRCm39) missense probably benign
R6647:Grin2b UTSW 6 135,710,108 (GRCm39) missense probably damaging 1.00
R6806:Grin2b UTSW 6 135,751,826 (GRCm39) missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135,757,198 (GRCm39) missense probably benign
R7033:Grin2b UTSW 6 135,900,036 (GRCm39) missense probably damaging 1.00
R7058:Grin2b UTSW 6 135,757,304 (GRCm39) missense probably damaging 0.97
R7144:Grin2b UTSW 6 135,710,474 (GRCm39) missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135,709,946 (GRCm39) missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135,757,249 (GRCm39) missense probably damaging 0.97
R7453:Grin2b UTSW 6 135,717,947 (GRCm39) missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135,749,394 (GRCm39) missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135,756,301 (GRCm39) missense probably damaging 0.99
R7615:Grin2b UTSW 6 135,900,362 (GRCm39) missense probably damaging 1.00
R7632:Grin2b UTSW 6 135,709,553 (GRCm39) missense probably benign 0.02
R7779:Grin2b UTSW 6 135,755,792 (GRCm39) nonsense probably null
R8058:Grin2b UTSW 6 135,710,225 (GRCm39) missense probably damaging 1.00
R8084:Grin2b UTSW 6 135,710,486 (GRCm39) missense probably benign 0.03
R8145:Grin2b UTSW 6 135,709,497 (GRCm39) missense probably benign 0.01
R8308:Grin2b UTSW 6 135,900,074 (GRCm39) missense probably damaging 0.99
R8357:Grin2b UTSW 6 135,709,197 (GRCm39) missense probably benign 0.00
R8379:Grin2b UTSW 6 135,899,967 (GRCm39) missense probably damaging 1.00
R8429:Grin2b UTSW 6 135,710,914 (GRCm39) missense probably damaging 1.00
R8457:Grin2b UTSW 6 135,709,197 (GRCm39) missense probably benign 0.00
R8746:Grin2b UTSW 6 135,899,985 (GRCm39) missense probably benign 0.02
R8925:Grin2b UTSW 6 135,749,339 (GRCm39) missense probably damaging 0.97
R8927:Grin2b UTSW 6 135,749,339 (GRCm39) missense probably damaging 0.97
R8963:Grin2b UTSW 6 136,021,007 (GRCm39) missense probably damaging 1.00
R9075:Grin2b UTSW 6 135,709,509 (GRCm39) frame shift probably null
R9076:Grin2b UTSW 6 135,709,509 (GRCm39) frame shift probably null
R9172:Grin2b UTSW 6 135,756,255 (GRCm39) missense possibly damaging 0.84
R9520:Grin2b UTSW 6 135,710,399 (GRCm39) missense probably damaging 1.00
R9740:Grin2b UTSW 6 135,899,868 (GRCm39) critical splice donor site probably null
RF001:Grin2b UTSW 6 136,021,238 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCATCAAATTTGACTTGGAAACAG -3'
(R):5'- TTACTGCTCCTGAGTGAGGG -3'

Sequencing Primer
(F):5'- AATTTGACTTGGAAACAGTCTTTTG -3'
(R):5'- CTCCTGAGTGAGGGCTAATG -3'
Posted On 2018-06-22