Incidental Mutation 'R6505:Disp1'
ID 523672
Institutional Source Beutler Lab
Gene Symbol Disp1
Ensembl Gene ENSMUSG00000030768
Gene Name dispatched RND transporter family member 1
Synonyms DispA, 1190008H24Rik
MMRRC Submission 044637-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.929) question?
Stock # R6505 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 182867830-183003086 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 182868076 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1448 (N1448S)
Ref Sequence ENSEMBL: ENSMUSP00000141747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003035] [ENSMUST00000171366] [ENSMUST00000195372]
AlphaFold Q3TDN0
Predicted Effect probably benign
Transcript: ENSMUST00000003035
AA Change: N1448S

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000003035
Gene: ENSMUSG00000030768
AA Change: N1448S

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 279 765 6.8e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 518 670 1.7e-15 PFAM
Pfam:Patched 916 1130 8e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171366
AA Change: N1448S

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000126742
Gene: ENSMUSG00000030768
AA Change: N1448S

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 272 766 2.6e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 516 671 2.2e-15 PFAM
Pfam:Patched 921 1130 8.7e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195372
AA Change: N1448S

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000141747
Gene: ENSMUSG00000030768
AA Change: N1448S

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 272 766 2.6e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 516 671 2.2e-15 PFAM
Pfam:Patched 921 1130 8.7e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted and chemically induced mutations exhibit a dorsalized neural tube, impaired heart looping, pericardial edema, large forelimbs, and abnormal head shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,220,772 (GRCm39) I424L probably benign Het
2610028H24Rik C T 10: 76,285,115 (GRCm39) A8V probably benign Het
Ago1 G A 4: 126,357,628 (GRCm39) P16S probably benign Het
Ak5 C T 3: 152,187,306 (GRCm39) E394K probably benign Het
Aldh7a1 T C 18: 56,660,068 (GRCm39) Y498C probably damaging Het
Alox12 T A 11: 70,141,030 (GRCm39) D335V probably damaging Het
Alx4 A T 2: 93,498,904 (GRCm39) Y212F probably damaging Het
Asb16 A G 11: 102,167,303 (GRCm39) E223G probably damaging Het
Atg9b C T 5: 24,595,575 (GRCm39) V235M probably damaging Het
BB014433 A G 8: 15,092,304 (GRCm39) V183A probably benign Het
Brca1 T A 11: 101,414,367 (GRCm39) M1256L probably benign Het
Bst1 A G 5: 43,977,932 (GRCm39) I94V probably benign Het
C3ar1 A G 6: 122,827,599 (GRCm39) L206P probably benign Het
Cabs1 T A 5: 88,128,522 (GRCm39) M391K possibly damaging Het
Cars1 C T 7: 143,118,744 (GRCm39) R599Q probably damaging Het
Ccdc190 T A 1: 169,760,592 (GRCm39) Y73* probably null Het
Cd177 A C 7: 24,443,671 (GRCm39) L809W probably benign Het
Cemip C A 7: 83,600,805 (GRCm39) G939* probably null Het
Clca3b T A 3: 144,531,020 (GRCm39) I777F probably benign Het
Cma2 T C 14: 56,211,236 (GRCm39) I176T probably damaging Het
Col12a1 T A 9: 79,554,887 (GRCm39) T2064S probably damaging Het
Csf1r A G 18: 61,262,805 (GRCm39) N860S probably damaging Het
Dab1 T A 4: 104,369,461 (GRCm39) C3S probably benign Het
Dennd4b A G 3: 90,174,918 (GRCm39) E50G probably damaging Het
Dis3l A T 9: 64,214,795 (GRCm39) S925T probably benign Het
Dpp10 T C 1: 123,264,580 (GRCm39) I747M probably damaging Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Ephx4 A T 5: 107,551,522 (GRCm39) K36* probably null Het
Fam135a C T 1: 24,053,953 (GRCm39) V1195I probably damaging Het
Fap A T 2: 62,376,947 (GRCm39) Y234* probably null Het
Fem1c A T 18: 46,638,942 (GRCm39) N353K possibly damaging Het
Furin C A 7: 80,043,365 (GRCm39) R282L probably damaging Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm5930 A G 14: 44,568,828 (GRCm39) *265Q probably null Het
Hcrtr1 T A 4: 130,031,379 (GRCm39) T15S probably benign Het
Ifnar1 C T 16: 91,296,425 (GRCm39) Q309* probably null Het
Il18r1 A T 1: 40,528,867 (GRCm39) I304L probably benign Het
Ino80 A T 2: 119,281,922 (GRCm39) Y185N probably damaging Het
Itgb2 G A 10: 77,395,507 (GRCm39) C536Y probably damaging Het
Ivns1abp T C 1: 151,236,744 (GRCm39) M435T probably benign Het
Kcnh4 T C 11: 100,647,911 (GRCm39) N151D probably benign Het
Lama3 T C 18: 12,628,405 (GRCm39) M1499T probably benign Het
Lamb1 A T 12: 31,373,461 (GRCm39) T1397S possibly damaging Het
Leng1 G A 7: 3,664,211 (GRCm39) R239* probably null Het
Map2k4 A T 11: 65,584,355 (GRCm39) N309K possibly damaging Het
Mcm3 A G 1: 20,873,768 (GRCm39) F784S probably damaging Het
Mrgpra9 T A 7: 46,884,884 (GRCm39) N260I probably benign Het
Mrnip C A 11: 50,090,679 (GRCm39) T281N possibly damaging Het
Myo9b A G 8: 71,808,501 (GRCm39) T1715A possibly damaging Het
Nectin3 A G 16: 46,269,184 (GRCm39) I406T possibly damaging Het
Neto1 A G 18: 86,516,699 (GRCm39) T339A possibly damaging Het
Ntn1 T C 11: 68,104,025 (GRCm39) D541G probably damaging Het
Nuak2 C A 1: 132,244,132 (GRCm39) H55Q probably damaging Het
Nufip2 A G 11: 77,582,439 (GRCm39) T118A probably benign Het
Or11i1 T G 3: 106,729,638 (GRCm39) N79T possibly damaging Het
Or12e7 T A 2: 87,288,271 (GRCm39) V254E probably damaging Het
Or51af1 T A 7: 103,141,858 (GRCm39) T76S probably damaging Het
Or52e19 C A 7: 102,959,000 (GRCm39) A24D probably benign Het
Or5d16 A T 2: 87,773,518 (GRCm39) Y151* probably null Het
Or5p59 T C 7: 107,702,774 (GRCm39) V86A probably benign Het
Or6d13 C T 6: 116,517,561 (GRCm39) T49M probably benign Het
Or7a40 A T 16: 16,491,784 (GRCm39) D20E probably benign Het
Or7g29 T C 9: 19,286,237 (GRCm39) *313W probably null Het
Pcdhb5 T A 18: 37,453,933 (GRCm39) H104Q probably benign Het
Phf11a T C 14: 59,514,986 (GRCm39) R232G probably damaging Het
Pik3r5 C T 11: 68,383,615 (GRCm39) T478I probably benign Het
Prkacb T A 3: 146,438,401 (GRCm39) E380V probably damaging Het
Prl7c1 G T 13: 27,957,776 (GRCm39) D221E probably damaging Het
Prr11 T A 11: 86,996,950 (GRCm39) K5* probably null Het
Prrc2b G A 2: 32,112,332 (GRCm39) G1932D probably damaging Het
Rexo1 A T 10: 80,378,845 (GRCm39) Y1064N possibly damaging Het
Rnf182 C T 13: 43,822,147 (GRCm39) Q233* probably null Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sash1 C G 10: 8,605,291 (GRCm39) G1033A probably benign Het
Sncaip C A 18: 53,039,609 (GRCm39) S189* probably null Het
Sorl1 T C 9: 41,982,530 (GRCm39) Y350C probably damaging Het
Speg T C 1: 75,383,328 (GRCm39) V1141A possibly damaging Het
Speg C A 1: 75,406,167 (GRCm39) D3091E possibly damaging Het
Sucnr1 A T 3: 59,994,144 (GRCm39) D224V probably benign Het
Tg G A 15: 66,631,407 (GRCm39) A559T probably damaging Het
Tmem132d A G 5: 127,861,502 (GRCm39) I873T probably benign Het
Tmem229a C T 6: 24,954,920 (GRCm39) C278Y probably damaging Het
Togaram1 T C 12: 65,013,364 (GRCm39) I205T possibly damaging Het
Usp19 T A 9: 108,374,082 (GRCm39) L713Q probably damaging Het
Vsig10 A G 5: 117,489,824 (GRCm39) D530G possibly damaging Het
Zfp106 A G 2: 120,364,983 (GRCm39) S475P probably damaging Het
Other mutations in Disp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB006:Disp1 UTSW 1 182,917,103 (GRCm39) missense probably benign
BB016:Disp1 UTSW 1 182,917,103 (GRCm39) missense probably benign
R1120:Disp1 UTSW 1 182,880,139 (GRCm39) missense probably benign 0.24
R1482:Disp1 UTSW 1 182,868,038 (GRCm39) missense possibly damaging 0.61
R1655:Disp1 UTSW 1 182,868,568 (GRCm39) missense probably benign 0.01
R1660:Disp1 UTSW 1 182,869,306 (GRCm39) missense probably damaging 1.00
R1816:Disp1 UTSW 1 182,880,139 (GRCm39) missense probably damaging 0.99
R1835:Disp1 UTSW 1 182,870,564 (GRCm39) missense probably damaging 1.00
R1954:Disp1 UTSW 1 182,870,107 (GRCm39) missense probably damaging 0.99
R2025:Disp1 UTSW 1 182,869,767 (GRCm39) missense probably damaging 1.00
R2136:Disp1 UTSW 1 182,869,942 (GRCm39) missense probably damaging 1.00
R2150:Disp1 UTSW 1 182,869,936 (GRCm39) missense probably damaging 1.00
R2207:Disp1 UTSW 1 182,869,906 (GRCm39) missense possibly damaging 0.94
R2392:Disp1 UTSW 1 182,868,731 (GRCm39) missense probably benign
R2831:Disp1 UTSW 1 182,870,883 (GRCm39) small deletion probably benign
R3111:Disp1 UTSW 1 182,869,087 (GRCm39) missense probably damaging 1.00
R3116:Disp1 UTSW 1 182,870,486 (GRCm39) missense probably benign 0.01
R3160:Disp1 UTSW 1 182,868,806 (GRCm39) missense probably benign 0.09
R3161:Disp1 UTSW 1 182,868,806 (GRCm39) missense probably benign 0.09
R3162:Disp1 UTSW 1 182,868,806 (GRCm39) missense probably benign 0.09
R3162:Disp1 UTSW 1 182,868,806 (GRCm39) missense probably benign 0.09
R3716:Disp1 UTSW 1 182,869,315 (GRCm39) missense probably damaging 1.00
R3914:Disp1 UTSW 1 182,870,666 (GRCm39) missense probably benign 0.05
R4061:Disp1 UTSW 1 182,869,264 (GRCm39) missense probably damaging 0.96
R4191:Disp1 UTSW 1 182,870,737 (GRCm39) missense probably damaging 1.00
R4261:Disp1 UTSW 1 182,870,950 (GRCm39) missense probably damaging 1.00
R4272:Disp1 UTSW 1 182,869,208 (GRCm39) missense possibly damaging 0.95
R4273:Disp1 UTSW 1 182,869,208 (GRCm39) missense possibly damaging 0.95
R4351:Disp1 UTSW 1 182,881,542 (GRCm39) missense probably benign 0.01
R4672:Disp1 UTSW 1 182,880,215 (GRCm39) critical splice acceptor site probably null
R4764:Disp1 UTSW 1 182,869,660 (GRCm39) missense probably damaging 1.00
R4910:Disp1 UTSW 1 182,917,027 (GRCm39) missense probably damaging 1.00
R5150:Disp1 UTSW 1 182,871,063 (GRCm39) missense probably damaging 0.98
R5502:Disp1 UTSW 1 182,869,450 (GRCm39) missense probably damaging 1.00
R5616:Disp1 UTSW 1 182,869,913 (GRCm39) missense probably benign 0.30
R5699:Disp1 UTSW 1 182,870,119 (GRCm39) nonsense probably null
R5813:Disp1 UTSW 1 182,869,974 (GRCm39) missense probably damaging 1.00
R5820:Disp1 UTSW 1 182,917,151 (GRCm39) missense probably benign 0.00
R6184:Disp1 UTSW 1 182,867,896 (GRCm39) missense probably benign 0.00
R6228:Disp1 UTSW 1 182,880,589 (GRCm39) missense possibly damaging 0.59
R6306:Disp1 UTSW 1 182,868,712 (GRCm39) missense possibly damaging 0.93
R6925:Disp1 UTSW 1 182,868,042 (GRCm39) missense probably benign
R7016:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7045:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7046:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7047:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7114:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7123:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7124:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7125:Disp1 UTSW 1 182,869,030 (GRCm39) missense probably damaging 1.00
R7161:Disp1 UTSW 1 182,869,189 (GRCm39) missense possibly damaging 0.84
R7510:Disp1 UTSW 1 182,869,975 (GRCm39) missense probably damaging 1.00
R7756:Disp1 UTSW 1 182,871,298 (GRCm39) missense probably damaging 1.00
R7800:Disp1 UTSW 1 182,880,550 (GRCm39) missense probably benign 0.00
R7929:Disp1 UTSW 1 182,917,103 (GRCm39) missense probably benign
R8029:Disp1 UTSW 1 182,870,852 (GRCm39) missense probably damaging 1.00
R8036:Disp1 UTSW 1 182,870,803 (GRCm39) missense probably damaging 1.00
R8045:Disp1 UTSW 1 182,870,794 (GRCm39) missense probably damaging 1.00
R8054:Disp1 UTSW 1 182,869,812 (GRCm39) nonsense probably null
R8061:Disp1 UTSW 1 182,869,151 (GRCm39) missense probably damaging 1.00
R8094:Disp1 UTSW 1 182,869,192 (GRCm39) missense probably damaging 1.00
R8130:Disp1 UTSW 1 182,917,199 (GRCm39) missense probably benign 0.13
R8731:Disp1 UTSW 1 182,869,072 (GRCm39) missense possibly damaging 0.65
R9076:Disp1 UTSW 1 182,868,799 (GRCm39) missense possibly damaging 0.59
R9490:Disp1 UTSW 1 182,871,092 (GRCm39) missense probably benign 0.03
R9712:Disp1 UTSW 1 182,917,379 (GRCm39) missense probably damaging 0.99
R9745:Disp1 UTSW 1 182,869,310 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCTTCTGAAGGCAATGCTAG -3'
(R):5'- AAGAGCTTGTTGCCATCCTGAG -3'

Sequencing Primer
(F):5'- TTTATTAACAGACTCTCGCCAGACAG -3'
(R):5'- GAGCTTGTTGCCATCCTGAGAATAAC -3'
Posted On 2018-06-22