Incidental Mutation 'R6505:Disp1'
ID523672
Institutional Source Beutler Lab
Gene Symbol Disp1
Ensembl Gene ENSMUSG00000030768
Gene Namedispatched RND transporter family member 1
Synonyms1190008H24Rik, DispA
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R6505 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location183086266-183221522 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 183086512 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 1448 (N1448S)
Ref Sequence ENSEMBL: ENSMUSP00000141747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003035] [ENSMUST00000171366] [ENSMUST00000195372]
Predicted Effect probably benign
Transcript: ENSMUST00000003035
AA Change: N1448S

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000003035
Gene: ENSMUSG00000030768
AA Change: N1448S

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 279 765 6.8e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 518 670 1.7e-15 PFAM
Pfam:Patched 916 1130 8e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171366
AA Change: N1448S

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000126742
Gene: ENSMUSG00000030768
AA Change: N1448S

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 272 766 2.6e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 516 671 2.2e-15 PFAM
Pfam:Patched 921 1130 8.7e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195372
AA Change: N1448S

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000141747
Gene: ENSMUSG00000030768
AA Change: N1448S

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
low complexity region 71 89 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
Pfam:Patched 272 766 2.6e-20 PFAM
Pfam:MMPL 496 691 6.6e-13 PFAM
Pfam:Sterol-sensing 516 671 2.2e-15 PFAM
Pfam:Patched 921 1130 8.7e-11 PFAM
Pfam:MMPL 937 1144 3.9e-9 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted and chemically induced mutations exhibit a dorsalized neural tube, impaired heart looping, pericardial edema, large forelimbs, and abnormal head shape. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,001,940 I424L probably benign Het
2610028H24Rik C T 10: 76,449,281 A8V probably benign Het
Ago1 G A 4: 126,463,835 P16S probably benign Het
Ak5 C T 3: 152,481,669 E394K probably benign Het
Aldh7a1 T C 18: 56,526,996 Y498C probably damaging Het
Alox12 T A 11: 70,250,204 D335V probably damaging Het
Alx4 A T 2: 93,668,559 Y212F probably damaging Het
Asb16 A G 11: 102,276,477 E223G probably damaging Het
Atg9b C T 5: 24,390,577 V235M probably damaging Het
BB014433 A G 8: 15,042,304 V183A probably benign Het
Brca1 T A 11: 101,523,541 M1256L probably benign Het
Bst1 A G 5: 43,820,590 I94V probably benign Het
C3ar1 A G 6: 122,850,640 L206P probably benign Het
Cabs1 T A 5: 87,980,663 M391K possibly damaging Het
Cars C T 7: 143,565,007 R599Q probably damaging Het
Ccdc190 T A 1: 169,933,023 Y73* probably null Het
Cd177 A C 7: 24,744,246 L809W probably benign Het
Cemip C A 7: 83,951,597 G939* probably null Het
Clca3b T A 3: 144,825,259 I777F probably benign Het
Cma2 T C 14: 55,973,779 I176T probably damaging Het
Col12a1 T A 9: 79,647,605 T2064S probably damaging Het
Csf1r A G 18: 61,129,733 N860S probably damaging Het
Dab1 T A 4: 104,512,264 C3S probably benign Het
Dennd4b A G 3: 90,267,611 E50G probably damaging Het
Dis3l A T 9: 64,307,513 S925T probably benign Het
Dpp10 T C 1: 123,336,851 I747M probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ephx4 A T 5: 107,403,656 K36* probably null Het
Fam135a C T 1: 24,014,872 V1195I probably damaging Het
Fap A T 2: 62,546,603 Y234* probably null Het
Fem1c A T 18: 46,505,875 N353K possibly damaging Het
Furin C A 7: 80,393,617 R282L probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5930 A G 14: 44,331,371 *265Q probably null Het
Hcrtr1 T A 4: 130,137,586 T15S probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Il18r1 A T 1: 40,489,707 I304L probably benign Het
Ino80 A T 2: 119,451,441 Y185N probably damaging Het
Itgb2 G A 10: 77,559,673 C536Y probably damaging Het
Ivns1abp T C 1: 151,360,993 M435T probably benign Het
Kcnh4 T C 11: 100,757,085 N151D probably benign Het
Lama3 T C 18: 12,495,348 M1499T probably benign Het
Lamb1 A T 12: 31,323,462 T1397S possibly damaging Het
Leng1 G A 7: 3,661,212 R239* probably null Het
Map2k4 A T 11: 65,693,529 N309K possibly damaging Het
Mcm3 A G 1: 20,803,544 F784S probably damaging Het
Mrgpra9 T A 7: 47,235,136 N260I probably benign Het
Mrnip C A 11: 50,199,852 T281N possibly damaging Het
Myo9b A G 8: 71,355,857 T1715A possibly damaging Het
Nectin3 A G 16: 46,448,821 I406T possibly damaging Het
Neto1 A G 18: 86,498,574 T339A possibly damaging Het
Ntn1 T C 11: 68,213,199 D541G probably damaging Het
Nuak2 C A 1: 132,316,394 H55Q probably damaging Het
Nufip2 A G 11: 77,691,613 T118A probably benign Het
Olfr1126 T A 2: 87,457,927 V254E probably damaging Het
Olfr1155 A T 2: 87,943,174 Y151* probably null Het
Olfr19 A T 16: 16,673,920 D20E probably benign Het
Olfr213 C T 6: 116,540,600 T49M probably benign Het
Olfr266 T G 3: 106,822,322 N79T possibly damaging Het
Olfr483 T C 7: 108,103,567 V86A probably benign Het
Olfr596 C A 7: 103,309,793 A24D probably benign Het
Olfr609 T A 7: 103,492,651 T76S probably damaging Het
Olfr847 T C 9: 19,374,941 *313W probably null Het
Pcdhb5 T A 18: 37,320,880 H104Q probably benign Het
Phf11a T C 14: 59,277,537 R232G probably damaging Het
Pik3r5 C T 11: 68,492,789 T478I probably benign Het
Prkacb T A 3: 146,732,646 E380V probably damaging Het
Prl7c1 G T 13: 27,773,793 D221E probably damaging Het
Prr11 T A 11: 87,106,124 K5* probably null Het
Prrc2b G A 2: 32,222,320 G1932D probably damaging Het
Rexo1 A T 10: 80,543,011 Y1064N possibly damaging Het
Rnf182 C T 13: 43,668,671 Q233* probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sash1 C G 10: 8,729,527 G1033A probably benign Het
Sncaip C A 18: 52,906,537 S189* probably null Het
Sorl1 T C 9: 42,071,234 Y350C probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Speg C A 1: 75,429,523 D3091E possibly damaging Het
Sucnr1 A T 3: 60,086,723 D224V probably benign Het
Tg G A 15: 66,759,558 A559T probably damaging Het
Tmem132d A G 5: 127,784,438 I873T probably benign Het
Tmem229a C T 6: 24,954,921 C278Y probably damaging Het
Togaram1 T C 12: 64,966,590 I205T possibly damaging Het
Usp19 T A 9: 108,496,883 L713Q probably damaging Het
Vsig10 A G 5: 117,351,759 D530G possibly damaging Het
Zfp106 A G 2: 120,534,502 S475P probably damaging Het
Other mutations in Disp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB006:Disp1 UTSW 1 183135539 missense probably benign
BB016:Disp1 UTSW 1 183135539 missense probably benign
R1120:Disp1 UTSW 1 183098575 missense probably benign 0.24
R1482:Disp1 UTSW 1 183086474 missense possibly damaging 0.61
R1655:Disp1 UTSW 1 183087004 missense probably benign 0.01
R1660:Disp1 UTSW 1 183087742 missense probably damaging 1.00
R1816:Disp1 UTSW 1 183098575 missense probably damaging 0.99
R1835:Disp1 UTSW 1 183089000 missense probably damaging 1.00
R1954:Disp1 UTSW 1 183088543 missense probably damaging 0.99
R2025:Disp1 UTSW 1 183088203 missense probably damaging 1.00
R2136:Disp1 UTSW 1 183088378 missense probably damaging 1.00
R2150:Disp1 UTSW 1 183088372 missense probably damaging 1.00
R2207:Disp1 UTSW 1 183088342 missense possibly damaging 0.94
R2392:Disp1 UTSW 1 183087167 missense probably benign
R2831:Disp1 UTSW 1 183089319 small deletion probably benign
R3111:Disp1 UTSW 1 183087523 missense probably damaging 1.00
R3116:Disp1 UTSW 1 183088922 missense probably benign 0.01
R3160:Disp1 UTSW 1 183087242 missense probably benign 0.09
R3161:Disp1 UTSW 1 183087242 missense probably benign 0.09
R3162:Disp1 UTSW 1 183087242 missense probably benign 0.09
R3162:Disp1 UTSW 1 183087242 missense probably benign 0.09
R3716:Disp1 UTSW 1 183087751 missense probably damaging 1.00
R3914:Disp1 UTSW 1 183089102 missense probably benign 0.05
R4061:Disp1 UTSW 1 183087700 missense probably damaging 0.96
R4191:Disp1 UTSW 1 183089173 missense probably damaging 1.00
R4261:Disp1 UTSW 1 183089386 missense probably damaging 1.00
R4272:Disp1 UTSW 1 183087644 missense possibly damaging 0.95
R4273:Disp1 UTSW 1 183087644 missense possibly damaging 0.95
R4351:Disp1 UTSW 1 183099978 missense probably benign 0.01
R4672:Disp1 UTSW 1 183098651 critical splice acceptor site probably null
R4764:Disp1 UTSW 1 183088096 missense probably damaging 1.00
R4910:Disp1 UTSW 1 183135463 missense probably damaging 1.00
R5150:Disp1 UTSW 1 183089499 missense probably damaging 0.98
R5502:Disp1 UTSW 1 183087886 missense probably damaging 1.00
R5616:Disp1 UTSW 1 183088349 missense probably benign 0.30
R5699:Disp1 UTSW 1 183088555 nonsense probably null
R5813:Disp1 UTSW 1 183088410 missense probably damaging 1.00
R5820:Disp1 UTSW 1 183135587 missense probably benign 0.00
R6184:Disp1 UTSW 1 183086332 missense probably benign 0.00
R6228:Disp1 UTSW 1 183099025 missense possibly damaging 0.59
R6306:Disp1 UTSW 1 183087148 missense possibly damaging 0.93
R6925:Disp1 UTSW 1 183086478 missense probably benign
R7016:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7045:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7046:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7047:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7114:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7123:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7124:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7125:Disp1 UTSW 1 183087466 missense probably damaging 1.00
R7161:Disp1 UTSW 1 183087625 missense possibly damaging 0.84
R7510:Disp1 UTSW 1 183088411 missense probably damaging 1.00
R7756:Disp1 UTSW 1 183089734 missense probably damaging 1.00
R7800:Disp1 UTSW 1 183098986 missense probably benign 0.00
R7929:Disp1 UTSW 1 183135539 missense probably benign
R8029:Disp1 UTSW 1 183089288 missense probably damaging 1.00
R8036:Disp1 UTSW 1 183089239 missense probably damaging 1.00
R8045:Disp1 UTSW 1 183089230 missense probably damaging 1.00
R8054:Disp1 UTSW 1 183088248 nonsense probably null
R8061:Disp1 UTSW 1 183087587 missense probably damaging 1.00
R8094:Disp1 UTSW 1 183087628 missense probably damaging 1.00
R8130:Disp1 UTSW 1 183135635 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGCTTCTGAAGGCAATGCTAG -3'
(R):5'- AAGAGCTTGTTGCCATCCTGAG -3'

Sequencing Primer
(F):5'- TTTATTAACAGACTCTCGCCAGACAG -3'
(R):5'- GAGCTTGTTGCCATCCTGAGAATAAC -3'
Posted On2018-06-22