Incidental Mutation 'R6505:Prrc2b'
ID523674
Institutional Source Beutler Lab
Gene Symbol Prrc2b
Ensembl Gene ENSMUSG00000039262
Gene Nameproline-rich coiled-coil 2B
Synonyms5830434P21Rik, Bat2l
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6505 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32151082-32234537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32222320 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 1932 (G1932D)
Ref Sequence ENSEMBL: ENSMUSP00000064892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036691] [ENSMUST00000069817]
Predicted Effect probably damaging
Transcript: ENSMUST00000036691
AA Change: G1246D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035734
Gene: ENSMUSG00000039262
AA Change: G1246D

DomainStartEndE-ValueType
Pfam:BAT2_N 1 194 2.7e-85 PFAM
low complexity region 359 374 N/A INTRINSIC
low complexity region 388 394 N/A INTRINSIC
low complexity region 413 424 N/A INTRINSIC
coiled coil region 494 544 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 638 656 N/A INTRINSIC
low complexity region 885 900 N/A INTRINSIC
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1112 1126 N/A INTRINSIC
low complexity region 1218 1233 N/A INTRINSIC
low complexity region 1257 1275 N/A INTRINSIC
low complexity region 1402 1421 N/A INTRINSIC
low complexity region 1425 1437 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069817
AA Change: G1932D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064892
Gene: ENSMUSG00000039262
AA Change: G1932D

DomainStartEndE-ValueType
Pfam:BAT2_N 1 191 3.1e-65 PFAM
low complexity region 359 374 N/A INTRINSIC
low complexity region 388 394 N/A INTRINSIC
low complexity region 413 424 N/A INTRINSIC
coiled coil region 494 544 N/A INTRINSIC
low complexity region 600 621 N/A INTRINSIC
low complexity region 638 656 N/A INTRINSIC
low complexity region 960 977 N/A INTRINSIC
low complexity region 1004 1018 N/A INTRINSIC
low complexity region 1070 1094 N/A INTRINSIC
low complexity region 1307 1325 N/A INTRINSIC
low complexity region 1388 1401 N/A INTRINSIC
low complexity region 1413 1426 N/A INTRINSIC
low complexity region 1572 1587 N/A INTRINSIC
low complexity region 1678 1693 N/A INTRINSIC
low complexity region 1798 1812 N/A INTRINSIC
low complexity region 1904 1919 N/A INTRINSIC
low complexity region 1943 1961 N/A INTRINSIC
low complexity region 2088 2107 N/A INTRINSIC
low complexity region 2111 2123 N/A INTRINSIC
low complexity region 2161 2174 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123270
Predicted Effect probably benign
Transcript: ENSMUST00000128936
SMART Domains Protein: ENSMUSP00000121664
Gene: ENSMUSG00000039262

DomainStartEndE-ValueType
low complexity region 53 68 N/A INTRINSIC
low complexity region 159 174 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129626
Predicted Effect probably damaging
Transcript: ENSMUST00000132459
AA Change: G1173D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116429
Gene: ENSMUSG00000039262
AA Change: G1173D

DomainStartEndE-ValueType
Pfam:BAT2_N 1 119 9.8e-24 PFAM
low complexity region 287 302 N/A INTRINSIC
low complexity region 316 322 N/A INTRINSIC
low complexity region 341 352 N/A INTRINSIC
coiled coil region 421 471 N/A INTRINSIC
low complexity region 528 549 N/A INTRINSIC
low complexity region 566 584 N/A INTRINSIC
low complexity region 813 828 N/A INTRINSIC
low complexity region 920 935 N/A INTRINSIC
low complexity region 1040 1054 N/A INTRINSIC
low complexity region 1146 1161 N/A INTRINSIC
low complexity region 1185 1203 N/A INTRINSIC
low complexity region 1330 1349 N/A INTRINSIC
low complexity region 1353 1365 N/A INTRINSIC
low complexity region 1403 1416 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142219
Predicted Effect probably benign
Transcript: ENSMUST00000156313
SMART Domains Protein: ENSMUSP00000114994
Gene: ENSMUSG00000039262

DomainStartEndE-ValueType
low complexity region 125 140 N/A INTRINSIC
low complexity region 231 246 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175128
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (84/84)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,001,940 I424L probably benign Het
2610028H24Rik C T 10: 76,449,281 A8V probably benign Het
Ago1 G A 4: 126,463,835 P16S probably benign Het
Ak5 C T 3: 152,481,669 E394K probably benign Het
Aldh7a1 T C 18: 56,526,996 Y498C probably damaging Het
Alox12 T A 11: 70,250,204 D335V probably damaging Het
Alx4 A T 2: 93,668,559 Y212F probably damaging Het
Asb16 A G 11: 102,276,477 E223G probably damaging Het
Atg9b C T 5: 24,390,577 V235M probably damaging Het
BB014433 A G 8: 15,042,304 V183A probably benign Het
Brca1 T A 11: 101,523,541 M1256L probably benign Het
Bst1 A G 5: 43,820,590 I94V probably benign Het
C3ar1 A G 6: 122,850,640 L206P probably benign Het
Cabs1 T A 5: 87,980,663 M391K possibly damaging Het
Cars C T 7: 143,565,007 R599Q probably damaging Het
Ccdc190 T A 1: 169,933,023 Y73* probably null Het
Cd177 A C 7: 24,744,246 L809W probably benign Het
Cemip C A 7: 83,951,597 G939* probably null Het
Clca3b T A 3: 144,825,259 I777F probably benign Het
Cma2 T C 14: 55,973,779 I176T probably damaging Het
Col12a1 T A 9: 79,647,605 T2064S probably damaging Het
Csf1r A G 18: 61,129,733 N860S probably damaging Het
Dab1 T A 4: 104,512,264 C3S probably benign Het
Dennd4b A G 3: 90,267,611 E50G probably damaging Het
Dis3l A T 9: 64,307,513 S925T probably benign Het
Disp1 T C 1: 183,086,512 N1448S probably benign Het
Dpp10 T C 1: 123,336,851 I747M probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ephx4 A T 5: 107,403,656 K36* probably null Het
Fam135a C T 1: 24,014,872 V1195I probably damaging Het
Fap A T 2: 62,546,603 Y234* probably null Het
Fem1c A T 18: 46,505,875 N353K possibly damaging Het
Furin C A 7: 80,393,617 R282L probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5930 A G 14: 44,331,371 *265Q probably null Het
Hcrtr1 T A 4: 130,137,586 T15S probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Il18r1 A T 1: 40,489,707 I304L probably benign Het
Ino80 A T 2: 119,451,441 Y185N probably damaging Het
Itgb2 G A 10: 77,559,673 C536Y probably damaging Het
Ivns1abp T C 1: 151,360,993 M435T probably benign Het
Kcnh4 T C 11: 100,757,085 N151D probably benign Het
Lama3 T C 18: 12,495,348 M1499T probably benign Het
Lamb1 A T 12: 31,323,462 T1397S possibly damaging Het
Leng1 G A 7: 3,661,212 R239* probably null Het
Map2k4 A T 11: 65,693,529 N309K possibly damaging Het
Mcm3 A G 1: 20,803,544 F784S probably damaging Het
Mrgpra9 T A 7: 47,235,136 N260I probably benign Het
Mrnip C A 11: 50,199,852 T281N possibly damaging Het
Myo9b A G 8: 71,355,857 T1715A possibly damaging Het
Nectin3 A G 16: 46,448,821 I406T possibly damaging Het
Neto1 A G 18: 86,498,574 T339A possibly damaging Het
Ntn1 T C 11: 68,213,199 D541G probably damaging Het
Nuak2 C A 1: 132,316,394 H55Q probably damaging Het
Nufip2 A G 11: 77,691,613 T118A probably benign Het
Olfr1126 T A 2: 87,457,927 V254E probably damaging Het
Olfr1155 A T 2: 87,943,174 Y151* probably null Het
Olfr19 A T 16: 16,673,920 D20E probably benign Het
Olfr213 C T 6: 116,540,600 T49M probably benign Het
Olfr266 T G 3: 106,822,322 N79T possibly damaging Het
Olfr483 T C 7: 108,103,567 V86A probably benign Het
Olfr596 C A 7: 103,309,793 A24D probably benign Het
Olfr609 T A 7: 103,492,651 T76S probably damaging Het
Olfr847 T C 9: 19,374,941 *313W probably null Het
Pcdhb5 T A 18: 37,320,880 H104Q probably benign Het
Phf11a T C 14: 59,277,537 R232G probably damaging Het
Pik3r5 C T 11: 68,492,789 T478I probably benign Het
Prkacb T A 3: 146,732,646 E380V probably damaging Het
Prl7c1 G T 13: 27,773,793 D221E probably damaging Het
Prr11 T A 11: 87,106,124 K5* probably null Het
Rexo1 A T 10: 80,543,011 Y1064N possibly damaging Het
Rnf182 C T 13: 43,668,671 Q233* probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sash1 C G 10: 8,729,527 G1033A probably benign Het
Sncaip C A 18: 52,906,537 S189* probably null Het
Sorl1 T C 9: 42,071,234 Y350C probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Speg C A 1: 75,429,523 D3091E possibly damaging Het
Sucnr1 A T 3: 60,086,723 D224V probably benign Het
Tg G A 15: 66,759,558 A559T probably damaging Het
Tmem132d A G 5: 127,784,438 I873T probably benign Het
Tmem229a C T 6: 24,954,921 C278Y probably damaging Het
Togaram1 T C 12: 64,966,590 I205T possibly damaging Het
Usp19 T A 9: 108,496,883 L713Q probably damaging Het
Vsig10 A G 5: 117,351,759 D530G possibly damaging Het
Zfp106 A G 2: 120,534,502 S475P probably damaging Het
Other mutations in Prrc2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Prrc2b APN 2 32208719 missense probably damaging 1.00
IGL00846:Prrc2b APN 2 32199097 splice site probably benign
IGL00977:Prrc2b APN 2 32213810 missense probably benign 0.05
IGL01372:Prrc2b APN 2 32223930 missense probably damaging 0.99
IGL01993:Prrc2b APN 2 32224045 missense possibly damaging 0.47
IGL02097:Prrc2b APN 2 32191501 splice site probably benign
IGL02165:Prrc2b APN 2 32214640 missense probably damaging 1.00
IGL02184:Prrc2b APN 2 32221455 missense probably benign 0.19
IGL02238:Prrc2b APN 2 32213417 missense probably damaging 1.00
IGL02338:Prrc2b APN 2 32214035 missense probably benign 0.01
IGL02399:Prrc2b APN 2 32226961 nonsense probably null
IGL02597:Prrc2b APN 2 32219613 missense probably damaging 1.00
IGL02729:Prrc2b APN 2 32208758 missense probably damaging 0.99
IGL02743:Prrc2b APN 2 32194429 missense probably damaging 1.00
IGL02815:Prrc2b APN 2 32204253 missense probably damaging 1.00
IGL03159:Prrc2b APN 2 32194486 missense probably damaging 0.98
BB002:Prrc2b UTSW 2 32204115 missense probably damaging 1.00
BB012:Prrc2b UTSW 2 32204115 missense probably damaging 1.00
FR4304:Prrc2b UTSW 2 32221167 missense probably damaging 1.00
R0082:Prrc2b UTSW 2 32212298 splice site probably benign
R0105:Prrc2b UTSW 2 32213311 nonsense probably null
R0276:Prrc2b UTSW 2 32219654 missense probably damaging 0.97
R0325:Prrc2b UTSW 2 32199091 missense probably damaging 1.00
R0436:Prrc2b UTSW 2 32230660 missense probably damaging 1.00
R0595:Prrc2b UTSW 2 32183177 missense probably damaging 1.00
R0607:Prrc2b UTSW 2 32213870 missense probably damaging 0.99
R0650:Prrc2b UTSW 2 32229255 splice site probably benign
R1282:Prrc2b UTSW 2 32223444 missense probably damaging 0.96
R1421:Prrc2b UTSW 2 32200978 missense possibly damaging 0.65
R1452:Prrc2b UTSW 2 32194985 missense probably damaging 1.00
R1535:Prrc2b UTSW 2 32204289 missense probably benign 0.06
R1709:Prrc2b UTSW 2 32194461 missense probably damaging 1.00
R1710:Prrc2b UTSW 2 32212222 missense probably damaging 0.99
R2094:Prrc2b UTSW 2 32182570 missense probably damaging 1.00
R2202:Prrc2b UTSW 2 32223464 missense probably damaging 1.00
R2203:Prrc2b UTSW 2 32223464 missense probably damaging 1.00
R2204:Prrc2b UTSW 2 32223464 missense probably damaging 1.00
R2428:Prrc2b UTSW 2 32216055 missense probably benign 0.00
R2435:Prrc2b UTSW 2 32219729 missense probably damaging 0.99
R3439:Prrc2b UTSW 2 32206347 missense probably benign 0.01
R4175:Prrc2b UTSW 2 32218808 intron probably benign
R4710:Prrc2b UTSW 2 32193857 missense possibly damaging 0.80
R4728:Prrc2b UTSW 2 32230625 missense probably damaging 1.00
R4791:Prrc2b UTSW 2 32217339 splice site probably null
R4876:Prrc2b UTSW 2 32214200 missense probably benign 0.00
R4908:Prrc2b UTSW 2 32226318 missense possibly damaging 0.94
R4997:Prrc2b UTSW 2 32222311 missense probably damaging 1.00
R5240:Prrc2b UTSW 2 32206396 missense probably benign 0.01
R5276:Prrc2b UTSW 2 32214722 missense probably benign 0.09
R5455:Prrc2b UTSW 2 32221343 critical splice acceptor site probably null
R5821:Prrc2b UTSW 2 32212132 missense probably damaging 0.99
R5835:Prrc2b UTSW 2 32206473 missense probably benign 0.18
R5958:Prrc2b UTSW 2 32212080 missense possibly damaging 0.89
R6052:Prrc2b UTSW 2 32212285 missense possibly damaging 0.92
R6218:Prrc2b UTSW 2 32208811 missense probably damaging 1.00
R6428:Prrc2b UTSW 2 32226496 splice site probably null
R6812:Prrc2b UTSW 2 32213141 missense probably benign 0.30
R6826:Prrc2b UTSW 2 32222288 critical splice acceptor site probably null
R6827:Prrc2b UTSW 2 32200951 missense probably benign 0.37
R7021:Prrc2b UTSW 2 32221486 missense probably damaging 1.00
R7078:Prrc2b UTSW 2 32213519 missense probably benign 0.01
R7081:Prrc2b UTSW 2 32213063 missense probably benign 0.12
R7101:Prrc2b UTSW 2 32226993 missense possibly damaging 0.68
R7215:Prrc2b UTSW 2 32229297 missense probably damaging 1.00
R7228:Prrc2b UTSW 2 32214306 nonsense probably null
R7566:Prrc2b UTSW 2 32194390 missense probably benign 0.02
R7719:Prrc2b UTSW 2 32217268 nonsense probably null
R7925:Prrc2b UTSW 2 32204115 missense probably damaging 1.00
R7999:Prrc2b UTSW 2 32194414 missense probably damaging 0.96
R8099:Prrc2b UTSW 2 32208674 missense probably benign 0.06
R8154:Prrc2b UTSW 2 32218677 missense probably benign 0.42
R8252:Prrc2b UTSW 2 32219380 missense possibly damaging 0.80
R8379:Prrc2b UTSW 2 32214654 missense probably damaging 0.96
Z1088:Prrc2b UTSW 2 32214429 missense probably benign 0.03
Z1088:Prrc2b UTSW 2 32216732 missense probably damaging 1.00
Z1177:Prrc2b UTSW 2 32226352 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTTCCATAGGAAACAGCCC -3'
(R):5'- ACTCTCTGGGTATCACATGGGG -3'

Sequencing Primer
(F):5'- ACCTGCCTGGGTTTCCTGAG -3'
(R):5'- GCAGGGGGCAAAATCACCC -3'
Posted On2018-06-22