Incidental Mutation 'R6505:Fap'
ID523675
Institutional Source Beutler Lab
Gene Symbol Fap
Ensembl Gene ENSMUSG00000000392
Gene Namefibroblast activation protein
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6505 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location62500943-62574075 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 62546603 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 234 (Y234*)
Ref Sequence ENSEMBL: ENSMUSP00000134386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000402] [ENSMUST00000102732] [ENSMUST00000173745] [ENSMUST00000174234] [ENSMUST00000174448]
Predicted Effect probably null
Transcript: ENSMUST00000000402
AA Change: Y206*
SMART Domains Protein: ENSMUSP00000000402
Gene: ENSMUSG00000000392
AA Change: Y206*

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:DPPIV_N 73 440 2e-110 PFAM
Pfam:Abhydrolase_5 504 719 2.4e-12 PFAM
Pfam:Abhydrolase_6 515 703 2.3e-10 PFAM
Pfam:Peptidase_S9 520 727 9.4e-60 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102732
AA Change: Y239*
SMART Domains Protein: ENSMUSP00000099793
Gene: ENSMUSG00000000392
AA Change: Y239*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 106 473 1.9e-106 PFAM
Pfam:Abhydrolase_5 537 752 2.9e-12 PFAM
Pfam:Peptidase_S9 553 760 1.5e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172676
Predicted Effect probably null
Transcript: ENSMUST00000173745
SMART Domains Protein: ENSMUSP00000134305
Gene: ENSMUSG00000000392

DomainStartEndE-ValueType
Pfam:DPPIV_N 12 63 2.9e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174234
AA Change: Y214*
SMART Domains Protein: ENSMUSP00000133792
Gene: ENSMUSG00000000392
AA Change: Y214*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 82 448 4.1e-108 PFAM
Pfam:Abhydrolase_5 512 727 6.4e-12 PFAM
Pfam:Abhydrolase_6 523 711 8.9e-10 PFAM
Pfam:Peptidase_S9 528 735 5.9e-59 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174448
AA Change: Y234*
SMART Domains Protein: ENSMUSP00000134386
Gene: ENSMUSG00000000392
AA Change: Y234*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 101 468 2.2e-110 PFAM
Pfam:Abhydrolase_5 532 747 2.5e-12 PFAM
Pfam:Abhydrolase_6 541 731 2.4e-10 PFAM
Pfam:Peptidase_S9 548 755 1e-59 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: This gene belongs to the serine protease family. The encoded protein is an inducible cell-surface bound glycoprotein specifically expressed in tumor-associated fibroblasts and pericytes of epithelial tumors and has protease and gelatinase activity. The protein plays a role in remodeling of the extracellular matrix (ECM) and may affect tumorigenesis and tissue repair. Alternately spliced transcript variants of this gene are described in the literature (PMID 9139873), but the full-length sequence of these variants is not available. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for a targeted null mutations exhibit no discernable phenotype; mice are viable and fertile with no change in cancer susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,001,940 I424L probably benign Het
2610028H24Rik C T 10: 76,449,281 A8V probably benign Het
Ago1 G A 4: 126,463,835 P16S probably benign Het
Ak5 C T 3: 152,481,669 E394K probably benign Het
Aldh7a1 T C 18: 56,526,996 Y498C probably damaging Het
Alox12 T A 11: 70,250,204 D335V probably damaging Het
Alx4 A T 2: 93,668,559 Y212F probably damaging Het
Asb16 A G 11: 102,276,477 E223G probably damaging Het
Atg9b C T 5: 24,390,577 V235M probably damaging Het
BB014433 A G 8: 15,042,304 V183A probably benign Het
Brca1 T A 11: 101,523,541 M1256L probably benign Het
Bst1 A G 5: 43,820,590 I94V probably benign Het
C3ar1 A G 6: 122,850,640 L206P probably benign Het
Cabs1 T A 5: 87,980,663 M391K possibly damaging Het
Cars C T 7: 143,565,007 R599Q probably damaging Het
Ccdc190 T A 1: 169,933,023 Y73* probably null Het
Cd177 A C 7: 24,744,246 L809W probably benign Het
Cemip C A 7: 83,951,597 G939* probably null Het
Clca3b T A 3: 144,825,259 I777F probably benign Het
Cma2 T C 14: 55,973,779 I176T probably damaging Het
Col12a1 T A 9: 79,647,605 T2064S probably damaging Het
Csf1r A G 18: 61,129,733 N860S probably damaging Het
Dab1 T A 4: 104,512,264 C3S probably benign Het
Dennd4b A G 3: 90,267,611 E50G probably damaging Het
Dis3l A T 9: 64,307,513 S925T probably benign Het
Disp1 T C 1: 183,086,512 N1448S probably benign Het
Dpp10 T C 1: 123,336,851 I747M probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ephx4 A T 5: 107,403,656 K36* probably null Het
Fam135a C T 1: 24,014,872 V1195I probably damaging Het
Fem1c A T 18: 46,505,875 N353K possibly damaging Het
Furin C A 7: 80,393,617 R282L probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5930 A G 14: 44,331,371 *265Q probably null Het
Hcrtr1 T A 4: 130,137,586 T15S probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Il18r1 A T 1: 40,489,707 I304L probably benign Het
Ino80 A T 2: 119,451,441 Y185N probably damaging Het
Itgb2 G A 10: 77,559,673 C536Y probably damaging Het
Ivns1abp T C 1: 151,360,993 M435T probably benign Het
Kcnh4 T C 11: 100,757,085 N151D probably benign Het
Lama3 T C 18: 12,495,348 M1499T probably benign Het
Lamb1 A T 12: 31,323,462 T1397S possibly damaging Het
Leng1 G A 7: 3,661,212 R239* probably null Het
Map2k4 A T 11: 65,693,529 N309K possibly damaging Het
Mcm3 A G 1: 20,803,544 F784S probably damaging Het
Mrgpra9 T A 7: 47,235,136 N260I probably benign Het
Mrnip C A 11: 50,199,852 T281N possibly damaging Het
Myo9b A G 8: 71,355,857 T1715A possibly damaging Het
Nectin3 A G 16: 46,448,821 I406T possibly damaging Het
Neto1 A G 18: 86,498,574 T339A possibly damaging Het
Ntn1 T C 11: 68,213,199 D541G probably damaging Het
Nuak2 C A 1: 132,316,394 H55Q probably damaging Het
Nufip2 A G 11: 77,691,613 T118A probably benign Het
Olfr1126 T A 2: 87,457,927 V254E probably damaging Het
Olfr1155 A T 2: 87,943,174 Y151* probably null Het
Olfr19 A T 16: 16,673,920 D20E probably benign Het
Olfr213 C T 6: 116,540,600 T49M probably benign Het
Olfr266 T G 3: 106,822,322 N79T possibly damaging Het
Olfr483 T C 7: 108,103,567 V86A probably benign Het
Olfr596 C A 7: 103,309,793 A24D probably benign Het
Olfr609 T A 7: 103,492,651 T76S probably damaging Het
Olfr847 T C 9: 19,374,941 *313W probably null Het
Pcdhb5 T A 18: 37,320,880 H104Q probably benign Het
Phf11a T C 14: 59,277,537 R232G probably damaging Het
Pik3r5 C T 11: 68,492,789 T478I probably benign Het
Prkacb T A 3: 146,732,646 E380V probably damaging Het
Prl7c1 G T 13: 27,773,793 D221E probably damaging Het
Prr11 T A 11: 87,106,124 K5* probably null Het
Prrc2b G A 2: 32,222,320 G1932D probably damaging Het
Rexo1 A T 10: 80,543,011 Y1064N possibly damaging Het
Rnf182 C T 13: 43,668,671 Q233* probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sash1 C G 10: 8,729,527 G1033A probably benign Het
Sncaip C A 18: 52,906,537 S189* probably null Het
Sorl1 T C 9: 42,071,234 Y350C probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Speg C A 1: 75,429,523 D3091E possibly damaging Het
Sucnr1 A T 3: 60,086,723 D224V probably benign Het
Tg G A 15: 66,759,558 A559T probably damaging Het
Tmem132d A G 5: 127,784,438 I873T probably benign Het
Tmem229a C T 6: 24,954,921 C278Y probably damaging Het
Togaram1 T C 12: 64,966,590 I205T possibly damaging Het
Usp19 T A 9: 108,496,883 L713Q probably damaging Het
Vsig10 A G 5: 117,351,759 D530G possibly damaging Het
Zfp106 A G 2: 120,534,502 S475P probably damaging Het
Other mutations in Fap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Fap APN 2 62524201 missense possibly damaging 0.82
IGL01420:Fap APN 2 62504502 splice site probably benign
IGL01485:Fap APN 2 62544311 missense possibly damaging 0.80
IGL01987:Fap APN 2 62528676 missense probably damaging 1.00
IGL02198:Fap APN 2 62554798 missense probably benign
IGL02355:Fap APN 2 62573498 missense probably benign 0.02
IGL02362:Fap APN 2 62573498 missense probably benign 0.02
IGL03227:Fap APN 2 62530763 critical splice acceptor site probably null
IGL03266:Fap APN 2 62537022 missense probably benign
IGL03369:Fap APN 2 62503355 splice site probably benign
IGL03406:Fap APN 2 62542122 splice site probably benign
ANU74:Fap UTSW 2 62547769 missense probably damaging 1.00
R0254:Fap UTSW 2 62503402 missense probably damaging 1.00
R0842:Fap UTSW 2 62537001 missense probably damaging 1.00
R1467:Fap UTSW 2 62517620 missense probably benign 0.18
R1467:Fap UTSW 2 62517620 missense probably benign 0.18
R1591:Fap UTSW 2 62553857 missense probably damaging 0.99
R1671:Fap UTSW 2 62553835 missense possibly damaging 0.46
R1674:Fap UTSW 2 62519005 missense probably benign
R1795:Fap UTSW 2 62548589 missense probably damaging 1.00
R1869:Fap UTSW 2 62528727 missense probably damaging 1.00
R2032:Fap UTSW 2 62542237 missense probably benign 0.43
R2136:Fap UTSW 2 62524207 missense possibly damaging 0.94
R3546:Fap UTSW 2 62519011 missense probably damaging 1.00
R3547:Fap UTSW 2 62519011 missense probably damaging 1.00
R3771:Fap UTSW 2 62533010 missense probably damaging 1.00
R3801:Fap UTSW 2 62546650 missense probably benign 0.04
R3910:Fap UTSW 2 62556104 missense probably damaging 1.00
R4306:Fap UTSW 2 62530707 critical splice donor site probably null
R4323:Fap UTSW 2 62503372 missense probably damaging 0.97
R4517:Fap UTSW 2 62530715 missense probably benign 0.01
R4793:Fap UTSW 2 62544369 missense probably damaging 1.00
R4812:Fap UTSW 2 62519021 missense probably damaging 1.00
R4843:Fap UTSW 2 62544374 missense probably damaging 1.00
R5281:Fap UTSW 2 62532961 critical splice donor site probably null
R5661:Fap UTSW 2 62536963 intron probably benign
R5696:Fap UTSW 2 62502459 missense probably damaging 1.00
R5750:Fap UTSW 2 62528714 missense probably damaging 1.00
R5898:Fap UTSW 2 62573503 missense probably benign
R5907:Fap UTSW 2 62544356 missense probably damaging 1.00
R5944:Fap UTSW 2 62542261 missense probably damaging 1.00
R5991:Fap UTSW 2 62518521 missense probably damaging 1.00
R6110:Fap UTSW 2 62554770 missense possibly damaging 0.91
R6270:Fap UTSW 2 62547788 missense probably damaging 0.98
R6631:Fap UTSW 2 62503381 missense probably damaging 1.00
R6896:Fap UTSW 2 62504600 nonsense probably null
R7138:Fap UTSW 2 62542178 missense probably benign 0.10
R7806:Fap UTSW 2 62503414 missense probably damaging 1.00
R8000:Fap UTSW 2 62502798 critical splice donor site probably null
R8115:Fap UTSW 2 62519041 missense probably benign 0.07
X0017:Fap UTSW 2 62556180 missense probably benign 0.04
X0026:Fap UTSW 2 62512390 missense probably damaging 1.00
Z1176:Fap UTSW 2 62528774 missense possibly damaging 0.87
Z1177:Fap UTSW 2 62502446 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAGTACAGTGTTTGCTTTATG -3'
(R):5'- GCAGAGTATGGCATATGTTACAC -3'

Sequencing Primer
(F):5'- TGACATACAAGGACAAGAAGCTTTC -3'
(R):5'- GGAAATGCTTGCCACAA -3'
Posted On2018-06-22