Incidental Mutation 'R6505:Fap'
ID 523675
Institutional Source Beutler Lab
Gene Symbol Fap
Ensembl Gene ENSMUSG00000000392
Gene Name fibroblast activation protein
Synonyms
MMRRC Submission 044637-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6505 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 62331280-62404365 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 62376947 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 234 (Y234*)
Ref Sequence ENSEMBL: ENSMUSP00000134386 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000402] [ENSMUST00000102732] [ENSMUST00000173745] [ENSMUST00000174234] [ENSMUST00000174448]
AlphaFold P97321
Predicted Effect probably null
Transcript: ENSMUST00000000402
AA Change: Y206*
SMART Domains Protein: ENSMUSP00000000402
Gene: ENSMUSG00000000392
AA Change: Y206*

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
Pfam:DPPIV_N 73 440 2e-110 PFAM
Pfam:Abhydrolase_5 504 719 2.4e-12 PFAM
Pfam:Abhydrolase_6 515 703 2.3e-10 PFAM
Pfam:Peptidase_S9 520 727 9.4e-60 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102732
AA Change: Y239*
SMART Domains Protein: ENSMUSP00000099793
Gene: ENSMUSG00000000392
AA Change: Y239*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 106 473 1.9e-106 PFAM
Pfam:Abhydrolase_5 537 752 2.9e-12 PFAM
Pfam:Peptidase_S9 553 760 1.5e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172676
Predicted Effect probably null
Transcript: ENSMUST00000173745
SMART Domains Protein: ENSMUSP00000134305
Gene: ENSMUSG00000000392

DomainStartEndE-ValueType
Pfam:DPPIV_N 12 63 2.9e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174234
AA Change: Y214*
SMART Domains Protein: ENSMUSP00000133792
Gene: ENSMUSG00000000392
AA Change: Y214*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 82 448 4.1e-108 PFAM
Pfam:Abhydrolase_5 512 727 6.4e-12 PFAM
Pfam:Abhydrolase_6 523 711 8.9e-10 PFAM
Pfam:Peptidase_S9 528 735 5.9e-59 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174448
AA Change: Y234*
SMART Domains Protein: ENSMUSP00000134386
Gene: ENSMUSG00000000392
AA Change: Y234*

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DPPIV_N 101 468 2.2e-110 PFAM
Pfam:Abhydrolase_5 532 747 2.5e-12 PFAM
Pfam:Abhydrolase_6 541 731 2.4e-10 PFAM
Pfam:Peptidase_S9 548 755 1e-59 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: This gene belongs to the serine protease family. The encoded protein is an inducible cell-surface bound glycoprotein specifically expressed in tumor-associated fibroblasts and pericytes of epithelial tumors and has protease and gelatinase activity. The protein plays a role in remodeling of the extracellular matrix (ECM) and may affect tumorigenesis and tissue repair. Alternately spliced transcript variants of this gene are described in the literature (PMID 9139873), but the full-length sequence of these variants is not available. [provided by RefSeq, Apr 2013]
PHENOTYPE: Mice homozygous for a targeted null mutations exhibit no discernable phenotype; mice are viable and fertile with no change in cancer susceptibility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,220,772 (GRCm39) I424L probably benign Het
2610028H24Rik C T 10: 76,285,115 (GRCm39) A8V probably benign Het
Ago1 G A 4: 126,357,628 (GRCm39) P16S probably benign Het
Ak5 C T 3: 152,187,306 (GRCm39) E394K probably benign Het
Aldh7a1 T C 18: 56,660,068 (GRCm39) Y498C probably damaging Het
Alox12 T A 11: 70,141,030 (GRCm39) D335V probably damaging Het
Alx4 A T 2: 93,498,904 (GRCm39) Y212F probably damaging Het
Asb16 A G 11: 102,167,303 (GRCm39) E223G probably damaging Het
Atg9b C T 5: 24,595,575 (GRCm39) V235M probably damaging Het
BB014433 A G 8: 15,092,304 (GRCm39) V183A probably benign Het
Brca1 T A 11: 101,414,367 (GRCm39) M1256L probably benign Het
Bst1 A G 5: 43,977,932 (GRCm39) I94V probably benign Het
C3ar1 A G 6: 122,827,599 (GRCm39) L206P probably benign Het
Cabs1 T A 5: 88,128,522 (GRCm39) M391K possibly damaging Het
Cars1 C T 7: 143,118,744 (GRCm39) R599Q probably damaging Het
Ccdc190 T A 1: 169,760,592 (GRCm39) Y73* probably null Het
Cd177 A C 7: 24,443,671 (GRCm39) L809W probably benign Het
Cemip C A 7: 83,600,805 (GRCm39) G939* probably null Het
Clca3b T A 3: 144,531,020 (GRCm39) I777F probably benign Het
Cma2 T C 14: 56,211,236 (GRCm39) I176T probably damaging Het
Col12a1 T A 9: 79,554,887 (GRCm39) T2064S probably damaging Het
Csf1r A G 18: 61,262,805 (GRCm39) N860S probably damaging Het
Dab1 T A 4: 104,369,461 (GRCm39) C3S probably benign Het
Dennd4b A G 3: 90,174,918 (GRCm39) E50G probably damaging Het
Dis3l A T 9: 64,214,795 (GRCm39) S925T probably benign Het
Disp1 T C 1: 182,868,076 (GRCm39) N1448S probably benign Het
Dpp10 T C 1: 123,264,580 (GRCm39) I747M probably damaging Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Ephx4 A T 5: 107,551,522 (GRCm39) K36* probably null Het
Fam135a C T 1: 24,053,953 (GRCm39) V1195I probably damaging Het
Fem1c A T 18: 46,638,942 (GRCm39) N353K possibly damaging Het
Furin C A 7: 80,043,365 (GRCm39) R282L probably damaging Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm5930 A G 14: 44,568,828 (GRCm39) *265Q probably null Het
Hcrtr1 T A 4: 130,031,379 (GRCm39) T15S probably benign Het
Ifnar1 C T 16: 91,296,425 (GRCm39) Q309* probably null Het
Il18r1 A T 1: 40,528,867 (GRCm39) I304L probably benign Het
Ino80 A T 2: 119,281,922 (GRCm39) Y185N probably damaging Het
Itgb2 G A 10: 77,395,507 (GRCm39) C536Y probably damaging Het
Ivns1abp T C 1: 151,236,744 (GRCm39) M435T probably benign Het
Kcnh4 T C 11: 100,647,911 (GRCm39) N151D probably benign Het
Lama3 T C 18: 12,628,405 (GRCm39) M1499T probably benign Het
Lamb1 A T 12: 31,373,461 (GRCm39) T1397S possibly damaging Het
Leng1 G A 7: 3,664,211 (GRCm39) R239* probably null Het
Map2k4 A T 11: 65,584,355 (GRCm39) N309K possibly damaging Het
Mcm3 A G 1: 20,873,768 (GRCm39) F784S probably damaging Het
Mrgpra9 T A 7: 46,884,884 (GRCm39) N260I probably benign Het
Mrnip C A 11: 50,090,679 (GRCm39) T281N possibly damaging Het
Myo9b A G 8: 71,808,501 (GRCm39) T1715A possibly damaging Het
Nectin3 A G 16: 46,269,184 (GRCm39) I406T possibly damaging Het
Neto1 A G 18: 86,516,699 (GRCm39) T339A possibly damaging Het
Ntn1 T C 11: 68,104,025 (GRCm39) D541G probably damaging Het
Nuak2 C A 1: 132,244,132 (GRCm39) H55Q probably damaging Het
Nufip2 A G 11: 77,582,439 (GRCm39) T118A probably benign Het
Or11i1 T G 3: 106,729,638 (GRCm39) N79T possibly damaging Het
Or12e7 T A 2: 87,288,271 (GRCm39) V254E probably damaging Het
Or51af1 T A 7: 103,141,858 (GRCm39) T76S probably damaging Het
Or52e19 C A 7: 102,959,000 (GRCm39) A24D probably benign Het
Or5d16 A T 2: 87,773,518 (GRCm39) Y151* probably null Het
Or5p59 T C 7: 107,702,774 (GRCm39) V86A probably benign Het
Or6d13 C T 6: 116,517,561 (GRCm39) T49M probably benign Het
Or7a40 A T 16: 16,491,784 (GRCm39) D20E probably benign Het
Or7g29 T C 9: 19,286,237 (GRCm39) *313W probably null Het
Pcdhb5 T A 18: 37,453,933 (GRCm39) H104Q probably benign Het
Phf11a T C 14: 59,514,986 (GRCm39) R232G probably damaging Het
Pik3r5 C T 11: 68,383,615 (GRCm39) T478I probably benign Het
Prkacb T A 3: 146,438,401 (GRCm39) E380V probably damaging Het
Prl7c1 G T 13: 27,957,776 (GRCm39) D221E probably damaging Het
Prr11 T A 11: 86,996,950 (GRCm39) K5* probably null Het
Prrc2b G A 2: 32,112,332 (GRCm39) G1932D probably damaging Het
Rexo1 A T 10: 80,378,845 (GRCm39) Y1064N possibly damaging Het
Rnf182 C T 13: 43,822,147 (GRCm39) Q233* probably null Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sash1 C G 10: 8,605,291 (GRCm39) G1033A probably benign Het
Sncaip C A 18: 53,039,609 (GRCm39) S189* probably null Het
Sorl1 T C 9: 41,982,530 (GRCm39) Y350C probably damaging Het
Speg T C 1: 75,383,328 (GRCm39) V1141A possibly damaging Het
Speg C A 1: 75,406,167 (GRCm39) D3091E possibly damaging Het
Sucnr1 A T 3: 59,994,144 (GRCm39) D224V probably benign Het
Tg G A 15: 66,631,407 (GRCm39) A559T probably damaging Het
Tmem132d A G 5: 127,861,502 (GRCm39) I873T probably benign Het
Tmem229a C T 6: 24,954,920 (GRCm39) C278Y probably damaging Het
Togaram1 T C 12: 65,013,364 (GRCm39) I205T possibly damaging Het
Usp19 T A 9: 108,374,082 (GRCm39) L713Q probably damaging Het
Vsig10 A G 5: 117,489,824 (GRCm39) D530G possibly damaging Het
Zfp106 A G 2: 120,364,983 (GRCm39) S475P probably damaging Het
Other mutations in Fap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Fap APN 2 62,354,545 (GRCm39) missense possibly damaging 0.82
IGL01420:Fap APN 2 62,334,846 (GRCm39) splice site probably benign
IGL01485:Fap APN 2 62,374,655 (GRCm39) missense possibly damaging 0.80
IGL01987:Fap APN 2 62,359,020 (GRCm39) missense probably damaging 1.00
IGL02198:Fap APN 2 62,385,142 (GRCm39) missense probably benign
IGL02355:Fap APN 2 62,403,842 (GRCm39) missense probably benign 0.02
IGL02362:Fap APN 2 62,403,842 (GRCm39) missense probably benign 0.02
IGL03227:Fap APN 2 62,361,107 (GRCm39) critical splice acceptor site probably null
IGL03266:Fap APN 2 62,367,366 (GRCm39) missense probably benign
IGL03369:Fap APN 2 62,333,699 (GRCm39) splice site probably benign
IGL03406:Fap APN 2 62,372,466 (GRCm39) splice site probably benign
mnemosyne UTSW 2 62,359,058 (GRCm39) missense probably damaging 1.00
R1467_Fap_571 UTSW 2 62,347,964 (GRCm39) missense probably benign 0.18
R4812_Fap_496 UTSW 2 62,349,365 (GRCm39) missense probably damaging 1.00
R5661_fap_070 UTSW 2 62,367,307 (GRCm39) intron probably benign
ANU74:Fap UTSW 2 62,378,113 (GRCm39) missense probably damaging 1.00
R0254:Fap UTSW 2 62,333,746 (GRCm39) missense probably damaging 1.00
R0842:Fap UTSW 2 62,367,345 (GRCm39) missense probably damaging 1.00
R1467:Fap UTSW 2 62,347,964 (GRCm39) missense probably benign 0.18
R1467:Fap UTSW 2 62,347,964 (GRCm39) missense probably benign 0.18
R1591:Fap UTSW 2 62,384,201 (GRCm39) missense probably damaging 0.99
R1671:Fap UTSW 2 62,384,179 (GRCm39) missense possibly damaging 0.46
R1674:Fap UTSW 2 62,349,349 (GRCm39) missense probably benign
R1795:Fap UTSW 2 62,378,933 (GRCm39) missense probably damaging 1.00
R1869:Fap UTSW 2 62,359,071 (GRCm39) missense probably damaging 1.00
R2032:Fap UTSW 2 62,372,581 (GRCm39) missense probably benign 0.43
R2136:Fap UTSW 2 62,354,551 (GRCm39) missense possibly damaging 0.94
R3546:Fap UTSW 2 62,349,355 (GRCm39) missense probably damaging 1.00
R3547:Fap UTSW 2 62,349,355 (GRCm39) missense probably damaging 1.00
R3771:Fap UTSW 2 62,363,354 (GRCm39) missense probably damaging 1.00
R3801:Fap UTSW 2 62,376,994 (GRCm39) missense probably benign 0.04
R3910:Fap UTSW 2 62,386,448 (GRCm39) missense probably damaging 1.00
R4306:Fap UTSW 2 62,361,051 (GRCm39) critical splice donor site probably null
R4323:Fap UTSW 2 62,333,716 (GRCm39) missense probably damaging 0.97
R4517:Fap UTSW 2 62,361,059 (GRCm39) missense probably benign 0.01
R4793:Fap UTSW 2 62,374,713 (GRCm39) missense probably damaging 1.00
R4812:Fap UTSW 2 62,349,365 (GRCm39) missense probably damaging 1.00
R4843:Fap UTSW 2 62,374,718 (GRCm39) missense probably damaging 1.00
R5281:Fap UTSW 2 62,363,305 (GRCm39) critical splice donor site probably null
R5661:Fap UTSW 2 62,367,307 (GRCm39) intron probably benign
R5696:Fap UTSW 2 62,332,803 (GRCm39) missense probably damaging 1.00
R5750:Fap UTSW 2 62,359,058 (GRCm39) missense probably damaging 1.00
R5898:Fap UTSW 2 62,403,847 (GRCm39) missense probably benign
R5907:Fap UTSW 2 62,374,700 (GRCm39) missense probably damaging 1.00
R5944:Fap UTSW 2 62,372,605 (GRCm39) missense probably damaging 1.00
R5991:Fap UTSW 2 62,348,865 (GRCm39) missense probably damaging 1.00
R6110:Fap UTSW 2 62,385,114 (GRCm39) missense possibly damaging 0.91
R6270:Fap UTSW 2 62,378,132 (GRCm39) missense probably damaging 0.98
R6631:Fap UTSW 2 62,333,725 (GRCm39) missense probably damaging 1.00
R6896:Fap UTSW 2 62,334,944 (GRCm39) nonsense probably null
R7138:Fap UTSW 2 62,372,522 (GRCm39) missense probably benign 0.10
R7806:Fap UTSW 2 62,333,758 (GRCm39) missense probably damaging 1.00
R8000:Fap UTSW 2 62,333,142 (GRCm39) critical splice donor site probably null
R8115:Fap UTSW 2 62,349,385 (GRCm39) missense probably benign 0.07
R8737:Fap UTSW 2 62,342,777 (GRCm39) missense probably benign 0.00
R8899:Fap UTSW 2 62,348,817 (GRCm39) missense probably damaging 1.00
R8924:Fap UTSW 2 62,378,165 (GRCm39) missense probably benign
R8972:Fap UTSW 2 62,378,927 (GRCm39) missense probably benign 0.02
R8998:Fap UTSW 2 62,367,368 (GRCm39) missense probably benign 0.12
R8999:Fap UTSW 2 62,367,368 (GRCm39) missense probably benign 0.12
R9418:Fap UTSW 2 62,385,181 (GRCm39) nonsense probably null
R9521:Fap UTSW 2 62,372,500 (GRCm39) missense probably benign
R9686:Fap UTSW 2 62,403,857 (GRCm39) missense possibly damaging 0.86
X0017:Fap UTSW 2 62,386,524 (GRCm39) missense probably benign 0.04
X0026:Fap UTSW 2 62,342,734 (GRCm39) missense probably damaging 1.00
Z1176:Fap UTSW 2 62,359,118 (GRCm39) missense possibly damaging 0.87
Z1177:Fap UTSW 2 62,332,790 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAGTACAGTGTTTGCTTTATG -3'
(R):5'- GCAGAGTATGGCATATGTTACAC -3'

Sequencing Primer
(F):5'- TGACATACAAGGACAAGAAGCTTTC -3'
(R):5'- GGAAATGCTTGCCACAA -3'
Posted On 2018-06-22