Incidental Mutation 'R6612:Gria4'
ID523676
Institutional Source Beutler Lab
Gene Symbol Gria4
Ensembl Gene ENSMUSG00000025892
Gene Nameglutamate receptor, ionotropic, AMPA4 (alpha 4)
SynonymsGluralpha4, spkw1, Glur4, Glur-4
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.586) question?
Stock #R6612 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location4417896-4796234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 4472206 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 428 (V428I)
Ref Sequence ENSEMBL: ENSMUSP00000148533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000212533]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027020
AA Change: V428I

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: V428I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 3e-61 PFAM
PBPe 416 791 8.23e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000063508
AA Change: V428I

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: V428I

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 39 380 2.5e-71 PFAM
PBPe 416 791 2.06e-129 SMART
Lig_chan-Glu_bd 426 491 3.4e-31 SMART
low complexity region 821 833 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000212533
AA Change: V428I

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1324 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.4%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,007 D320E possibly damaging Het
4930523C07Rik A C 1: 160,075,234 N25H probably damaging Het
Akr1c14 A T 13: 4,065,331 S87C probably benign Het
Arhgef37 T C 18: 61,494,881 T664A probably benign Het
Arsi A G 18: 60,912,456 T73A probably benign Het
Cacnb2 A T 2: 14,975,149 T274S probably benign Het
Cd244 A G 1: 171,574,104 T133A probably benign Het
Ciz1 T A 2: 32,377,311 S720T possibly damaging Het
Cxcr6 T A 9: 123,810,720 I262N probably damaging Het
Cyp2a4 T A 7: 26,308,647 F160I probably benign Het
Esrra T C 19: 6,911,852 T390A probably benign Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Gm17079 C A 14: 51,694,375 Q91H probably damaging Het
Gm17079 T A 14: 51,694,376 Q91L possibly damaging Het
Got1 A G 19: 43,504,803 S256P probably damaging Het
Grin2b A G 6: 135,740,998 Y699H probably damaging Het
Hipk2 T C 6: 38,818,873 I154V probably benign Het
Hkdc1 T C 10: 62,395,441 E628G possibly damaging Het
Hmcn1 C G 1: 150,595,118 probably null Het
Hspbap1 T G 16: 35,801,591 L102W probably damaging Het
Iqcb1 G A 16: 36,871,661 probably benign Het
Itga7 A G 10: 128,948,993 Y763C possibly damaging Het
Itgb4 A T 11: 115,984,071 D418V probably benign Het
Jakmip2 T C 18: 43,557,367 D631G probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Kcnu1 A G 8: 25,918,316 I52V probably benign Het
Kdm5a T C 6: 120,430,228 I1468T probably damaging Het
Kmt2d A G 15: 98,845,858 probably benign Het
Mab21l3 A G 3: 101,818,645 V345A possibly damaging Het
March10 A T 11: 105,397,078 S133T probably damaging Het
Mccc1 T C 3: 35,993,930 S115G probably benign Het
Mchr1 G A 15: 81,237,870 V274M probably damaging Het
Mrgpra3 T A 7: 47,590,035 I48F probably benign Het
Myo9a T A 9: 59,827,196 F687Y probably damaging Het
Nfrkb T A 9: 31,397,006 L216* probably null Het
Nrxn3 A T 12: 89,813,332 probably benign Het
Olfr746 A T 14: 50,653,633 Y132F probably damaging Het
Olig2 T A 16: 91,226,881 M161K probably damaging Het
Pcdh15 T A 10: 74,185,378 N141K probably damaging Het
Pcdha4 T C 18: 36,954,978 V738A probably benign Het
Pdgfra T C 5: 75,167,842 S212P probably benign Het
Plk3 G A 4: 117,132,737 Q194* probably null Het
Ppp1r36 T C 12: 76,437,604 I216T possibly damaging Het
Ptprz1 T A 6: 23,052,082 N2303K probably damaging Het
Rab25 G A 3: 88,543,403 T117M probably damaging Het
Slc25a47 T C 12: 108,855,978 V231A probably benign Het
Slx4 G A 16: 3,985,276 H1225Y probably damaging Het
Snx13 C T 12: 35,106,759 A470V probably benign Het
Spa17 A G 9: 37,605,794 F101S probably benign Het
Ssh1 C T 5: 113,958,730 A217T probably benign Het
Synm G C 7: 67,733,516 T1466S probably damaging Het
Tbc1d19 A G 5: 53,809,845 E29G possibly damaging Het
Teddm2 T A 1: 153,850,445 T175S probably benign Het
Tet2 T A 3: 133,487,335 H446L possibly damaging Het
Tmem110 T A 14: 30,871,564 probably null Het
Tpm3-rs7 G T 14: 113,314,836 R54L probably benign Het
Ttc5 T A 14: 50,785,469 probably null Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Ush2a T C 1: 188,911,397 S4319P possibly damaging Het
Zbtb10 C A 3: 9,252,065 H312Q possibly damaging Het
Zfp462 A T 4: 55,012,324 probably null Het
Other mutations in Gria4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Gria4 APN 9 4472202 missense probably damaging 0.98
IGL01451:Gria4 APN 9 4503652 missense probably benign 0.04
IGL01533:Gria4 APN 9 4502395 missense probably damaging 1.00
IGL01994:Gria4 APN 9 4537726 missense probably damaging 1.00
IGL02078:Gria4 APN 9 4793878 missense probably damaging 0.98
IGL02183:Gria4 APN 9 4502460 missense probably damaging 1.00
IGL02351:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL02358:Gria4 APN 9 4456206 missense possibly damaging 0.84
IGL03118:Gria4 APN 9 4793804 splice site probably benign
IGL03131:Gria4 APN 9 4432876 missense probably damaging 0.96
IGL03148:Gria4 APN 9 4464295 missense possibly damaging 0.91
IGL03264:Gria4 APN 9 4513288 missense probably benign
PIT4812001:Gria4 UTSW 9 4427128 missense probably damaging 1.00
R0018:Gria4 UTSW 9 4432843 missense possibly damaging 0.71
R0295:Gria4 UTSW 9 4793840 missense possibly damaging 0.69
R0654:Gria4 UTSW 9 4464372 missense probably benign 0.32
R0690:Gria4 UTSW 9 4427071 missense probably damaging 1.00
R0992:Gria4 UTSW 9 4795238 missense probably benign
R1517:Gria4 UTSW 9 4793865 missense probably damaging 1.00
R1673:Gria4 UTSW 9 4537637 nonsense probably null
R1713:Gria4 UTSW 9 4424448 missense probably benign 0.20
R1961:Gria4 UTSW 9 4519546 splice site probably benign
R2137:Gria4 UTSW 9 4427026 intron probably benign
R2397:Gria4 UTSW 9 4537717 missense probably damaging 1.00
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R2870:Gria4 UTSW 9 4503614 missense probably damaging 0.96
R3014:Gria4 UTSW 9 4464294 missense probably damaging 0.97
R3412:Gria4 UTSW 9 4513278 missense probably benign 0.00
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3732:Gria4 UTSW 9 4513295 missense probably benign
R3733:Gria4 UTSW 9 4513295 missense probably benign
R3897:Gria4 UTSW 9 4513260 missense probably damaging 1.00
R4404:Gria4 UTSW 9 4464489 splice site probably null
R4457:Gria4 UTSW 9 4427074 missense probably damaging 1.00
R4672:Gria4 UTSW 9 4664981 missense possibly damaging 0.96
R4865:Gria4 UTSW 9 4464295 missense possibly damaging 0.91
R5092:Gria4 UTSW 9 4472176 missense probably benign 0.01
R5109:Gria4 UTSW 9 4472168 missense probably damaging 1.00
R5202:Gria4 UTSW 9 4424330 missense probably benign 0.10
R5828:Gria4 UTSW 9 4432832 missense probably damaging 1.00
R5945:Gria4 UTSW 9 4456122 missense probably damaging 1.00
R5985:Gria4 UTSW 9 4503593 missense probably damaging 0.99
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6036:Gria4 UTSW 9 4537646 missense probably benign 0.00
R6111:Gria4 UTSW 9 4502430 missense probably damaging 1.00
R6190:Gria4 UTSW 9 4420199 missense probably benign
R6280:Gria4 UTSW 9 4456072 missense probably damaging 1.00
R6406:Gria4 UTSW 9 4427077 missense probably damaging 1.00
R6470:Gria4 UTSW 9 4503680 missense probably damaging 1.00
R6485:Gria4 UTSW 9 4464249 missense probably damaging 1.00
R6848:Gria4 UTSW 9 4793822 missense probably damaging 1.00
R7046:Gria4 UTSW 9 4420278 missense probably damaging 0.97
R7210:Gria4 UTSW 9 4464135 missense probably damaging 1.00
R7284:Gria4 UTSW 9 4472017 missense probably damaging 1.00
R7475:Gria4 UTSW 9 4513330 missense probably damaging 1.00
R7501:Gria4 UTSW 9 4502436 missense probably benign 0.01
R7536:Gria4 UTSW 9 4464298 missense probably damaging 1.00
R7604:Gria4 UTSW 9 4464315 missense probably damaging 1.00
R7643:Gria4 UTSW 9 4793950 missense probably benign 0.00
R7669:Gria4 UTSW 9 4462029 missense probably damaging 1.00
R7703:Gria4 UTSW 9 4503588 missense probably benign
R7720:Gria4 UTSW 9 4464288 missense probably damaging 1.00
R7724:Gria4 UTSW 9 4472074 missense probably damaging 1.00
X0023:Gria4 UTSW 9 4427067 missense probably damaging 1.00
X0065:Gria4 UTSW 9 4464340 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GCTTGCTTACCCCATACACAAG -3'
(R):5'- ATGCCTTCTCTGAGTAAAGCACC -3'

Sequencing Primer
(F):5'- TGCTTACCCCATACACAAGCTCTC -3'
(R):5'- CTCTGAGTAAAGCACCTTACTTAAC -3'
Posted On2018-06-22