Mutagenetix > Incidental Mutation

Incidental Mutation 'R6612:Gria4'

523676

Institutional Source

Beutler Lab

Gene Symbol

Gria4

Ensembl Gene

ENSMUSG00000025892

Gene Name

glutamate receptor, ionotropic, AMPA4 (alpha 4)

Synonyms

Gluralpha4, spkw1, Glur4, Glur-4

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.631) question?

Stock #

R6612 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

4417896-4796234 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 4472206 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 428 (V428I)

Ref Sequence

ENSEMBL: ENSMUSP00000148533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027020] [ENSMUST00000063508] [ENSMUST00000212533]

AlphaFold

Q9Z2W8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000027020
AA Change: V428I

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000027020
Gene: ENSMUSG00000025892
AA Change: V428I

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	3e-61	PFAM
PBPe	416	791	8.23e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000063508
AA Change: V428I

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000066980
Gene: ENSMUSG00000025892
AA Change: V428I

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	39	380	2.5e-71	PFAM
PBPe	416	791	2.06e-129	SMART
Lig_chan-Glu_bd	426	491	3.4e-31	SMART
low complexity region	821	833	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212533
AA Change: V428I

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)

Meta Mutation Damage Score

0.1324

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.4%

Validation Efficiency

95% (59/62)

MGI Phenotype

FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. These receptors are heteromeric protein complexes composed of multiple subunits, arranged to form ligand-gated ion channels. The classification of glutamate receptors is based on their activation by different pharmacologic agonists. The subunit encoded by this gene belongs to a family of AMPA (alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate)-sensitive glutamate receptors, and is subject to RNA editing (AGA->GGA; R->G). Alternative splicing of this gene results in transcript variants encoding different isoforms, which may vary in their signal transduction properties. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display hyperactivity, decreased thermal nociception, and abnormal sensitivity to pharmacologically induced seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,692,007	D320E	possibly damaging	Het
4930523C07Rik	A	C	1: 160,075,234	N25H	probably damaging	Het
Akr1c14	A	T	13: 4,065,331	S87C	probably benign	Het
Arhgef37	T	C	18: 61,494,881	T664A	probably benign	Het
Arsi	A	G	18: 60,912,456	T73A	probably benign	Het
Cacnb2	A	T	2: 14,975,149	T274S	probably benign	Het
Cd244	A	G	1: 171,574,104	T133A	probably benign	Het
Ciz1	T	A	2: 32,377,311	S720T	possibly damaging	Het
Cxcr6	T	A	9: 123,810,720	I262N	probably damaging	Het
Cyp2a4	T	A	7: 26,308,647	F160I	probably benign	Het
Esrra	T	C	19: 6,911,852	T390A	probably benign	Het
Fopnl	TTGTG	TTG	16: 14,300,145		probably null	Het
Gm17079	C	A	14: 51,694,375	Q91H	probably damaging	Het
Gm17079	T	A	14: 51,694,376	Q91L	possibly damaging	Het
Got1	A	G	19: 43,504,803	S256P	probably damaging	Het
Grin2b	A	G	6: 135,740,998	Y699H	probably damaging	Het
Hipk2	T	C	6: 38,818,873	I154V	probably benign	Het
Hkdc1	T	C	10: 62,395,441	E628G	possibly damaging	Het
Hmcn1	C	G	1: 150,595,118		probably null	Het
Hspbap1	T	G	16: 35,801,591	L102W	probably damaging	Het
Iqcb1	G	A	16: 36,871,661		probably benign	Het
Itga7	A	G	10: 128,948,993	Y763C	possibly damaging	Het
Itgb4	A	T	11: 115,984,071	D418V	probably benign	Het
Jakmip2	T	C	18: 43,557,367	D631G	probably damaging	Het
Kcnc2	G	C	10: 112,271,856	G51R	probably benign	Het
Kcnu1	A	G	8: 25,918,316	I52V	probably benign	Het
Kdm5a	T	C	6: 120,430,228	I1468T	probably damaging	Het
Kmt2d	A	G	15: 98,845,858		probably benign	Het
Mab21l3	A	G	3: 101,818,645	V345A	possibly damaging	Het
March10	A	T	11: 105,397,078	S133T	probably damaging	Het
Mccc1	T	C	3: 35,993,930	S115G	probably benign	Het
Mchr1	G	A	15: 81,237,870	V274M	probably damaging	Het
Mrgpra3	T	A	7: 47,590,035	I48F	probably benign	Het
Myo9a	T	A	9: 59,827,196	F687Y	probably damaging	Het
Nfrkb	T	A	9: 31,397,006	L216*	probably null	Het
Nrxn3	A	T	12: 89,813,332		probably benign	Het
Olfr746	A	T	14: 50,653,633	Y132F	probably damaging	Het
Olig2	T	A	16: 91,226,881	M161K	probably damaging	Het
Pcdh15	T	A	10: 74,185,378	N141K	probably damaging	Het
Pcdha4	T	C	18: 36,954,978	V738A	probably benign	Het
Pdgfra	T	C	5: 75,167,842	S212P	probably benign	Het
Plk3	G	A	4: 117,132,737	Q194*	probably null	Het
Ppp1r36	T	C	12: 76,437,604	I216T	possibly damaging	Het
Ptprz1	T	A	6: 23,052,082	N2303K	probably damaging	Het
Rab25	G	A	3: 88,543,403	T117M	probably damaging	Het
Slc25a47	T	C	12: 108,855,978	V231A	probably benign	Het
Slx4	G	A	16: 3,985,276	H1225Y	probably damaging	Het
Snx13	C	T	12: 35,106,759	A470V	probably benign	Het
Spa17	A	G	9: 37,605,794	F101S	probably benign	Het
Ssh1	C	T	5: 113,958,730	A217T	probably benign	Het
Synm	G	C	7: 67,733,516	T1466S	probably damaging	Het
Tbc1d19	A	G	5: 53,809,845	E29G	possibly damaging	Het
Teddm2	T	A	1: 153,850,445	T175S	probably benign	Het
Tet2	T	A	3: 133,487,335	H446L	possibly damaging	Het
Tmem110	T	A	14: 30,871,564		probably null	Het
Tpm3-rs7	G	T	14: 113,314,836	R54L	probably benign	Het
Ttc5	T	A	14: 50,785,469		probably null	Het
Tyk2	G	T	9: 21,108,016	Q1014K	probably benign	Het
Ush2a	T	C	1: 188,911,397	S4319P	possibly damaging	Het
Zbtb10	C	A	3: 9,252,065	H312Q	possibly damaging	Het
Zfp462	A	T	4: 55,012,324		probably null	Het

Other mutations in Gria4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00814:Gria4	APN	9	4472202	missense	probably damaging	0.98
IGL01451:Gria4	APN	9	4503652	missense	probably benign	0.04
IGL01533:Gria4	APN	9	4502395	missense	probably damaging	1.00
IGL01994:Gria4	APN	9	4537726	missense	probably damaging	1.00
IGL02078:Gria4	APN	9	4793878	missense	probably damaging	0.98
IGL02183:Gria4	APN	9	4502460	missense	probably damaging	1.00
IGL02351:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL02358:Gria4	APN	9	4456206	missense	possibly damaging	0.84
IGL03118:Gria4	APN	9	4793804	splice site	probably benign
IGL03131:Gria4	APN	9	4432876	missense	probably damaging	0.96
IGL03148:Gria4	APN	9	4464295	missense	possibly damaging	0.91
IGL03264:Gria4	APN	9	4513288	missense	probably benign
PIT4812001:Gria4	UTSW	9	4427128	missense	probably damaging	1.00
R0018:Gria4	UTSW	9	4432843	missense	possibly damaging	0.71
R0295:Gria4	UTSW	9	4793840	missense	possibly damaging	0.69
R0654:Gria4	UTSW	9	4464372	missense	probably benign	0.32
R0690:Gria4	UTSW	9	4427071	missense	probably damaging	1.00
R0992:Gria4	UTSW	9	4795238	missense	probably benign
R1517:Gria4	UTSW	9	4793865	missense	probably damaging	1.00
R1673:Gria4	UTSW	9	4537637	nonsense	probably null
R1713:Gria4	UTSW	9	4424448	missense	probably benign	0.20
R1961:Gria4	UTSW	9	4519546	splice site	probably benign
R2137:Gria4	UTSW	9	4427026	intron	probably benign
R2397:Gria4	UTSW	9	4537717	missense	probably damaging	1.00
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R2870:Gria4	UTSW	9	4503614	missense	probably damaging	0.96
R3014:Gria4	UTSW	9	4464294	missense	probably damaging	0.97
R3412:Gria4	UTSW	9	4513278	missense	probably benign	0.00
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3732:Gria4	UTSW	9	4513295	missense	probably benign
R3733:Gria4	UTSW	9	4513295	missense	probably benign
R3897:Gria4	UTSW	9	4513260	missense	probably damaging	1.00
R4404:Gria4	UTSW	9	4464489	splice site	probably null
R4457:Gria4	UTSW	9	4427074	missense	probably damaging	1.00
R4672:Gria4	UTSW	9	4664981	missense	possibly damaging	0.96
R4865:Gria4	UTSW	9	4464295	missense	possibly damaging	0.91
R5092:Gria4	UTSW	9	4472176	missense	probably benign	0.01
R5109:Gria4	UTSW	9	4472168	missense	probably damaging	1.00
R5202:Gria4	UTSW	9	4424330	missense	probably benign	0.10
R5828:Gria4	UTSW	9	4432832	missense	probably damaging	1.00
R5945:Gria4	UTSW	9	4456122	missense	probably damaging	1.00
R5985:Gria4	UTSW	9	4503593	missense	probably damaging	0.99
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6036:Gria4	UTSW	9	4537646	missense	probably benign	0.00
R6111:Gria4	UTSW	9	4502430	missense	probably damaging	1.00
R6190:Gria4	UTSW	9	4420199	missense	probably benign
R6280:Gria4	UTSW	9	4456072	missense	probably damaging	1.00
R6406:Gria4	UTSW	9	4427077	missense	probably damaging	1.00
R6470:Gria4	UTSW	9	4503680	missense	probably damaging	1.00
R6485:Gria4	UTSW	9	4464249	missense	probably damaging	1.00
R6848:Gria4	UTSW	9	4793822	missense	probably damaging	1.00
R7046:Gria4	UTSW	9	4420278	missense	probably damaging	0.97
R7210:Gria4	UTSW	9	4464135	missense	probably damaging	1.00
R7284:Gria4	UTSW	9	4472017	missense	probably damaging	1.00
R7475:Gria4	UTSW	9	4513330	missense	probably damaging	1.00
R7501:Gria4	UTSW	9	4502436	missense	probably benign	0.01
R7536:Gria4	UTSW	9	4464298	missense	probably damaging	1.00
R7604:Gria4	UTSW	9	4464315	missense	probably damaging	1.00
R7643:Gria4	UTSW	9	4793950	missense	probably benign	0.00
R7669:Gria4	UTSW	9	4462029	missense	probably damaging	1.00
R7703:Gria4	UTSW	9	4503588	missense	probably benign
R7720:Gria4	UTSW	9	4464288	missense	probably damaging	1.00
R7724:Gria4	UTSW	9	4472074	missense	probably damaging	1.00
R7909:Gria4	UTSW	9	4464450	missense	probably damaging	1.00
R8007:Gria4	UTSW	9	4503740	splice site	probably benign
R8044:Gria4	UTSW	9	4456216	missense	probably damaging	1.00
R8062:Gria4	UTSW	9	4480273	missense	possibly damaging	0.54
R8131:Gria4	UTSW	9	4502429	missense	probably benign	0.16
R8212:Gria4	UTSW	9	4480242	missense	probably benign
R8478:Gria4	UTSW	9	4793882	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424347	missense	probably damaging	1.00
R8699:Gria4	UTSW	9	4424351	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4456106	missense	probably damaging	1.00
R8785:Gria4	UTSW	9	4795189	missense	possibly damaging	0.92
R8888:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R8895:Gria4	UTSW	9	4664951	missense	probably damaging	1.00
R9160:Gria4	UTSW	9	4424412	missense	probably damaging	1.00
R9498:Gria4	UTSW	9	4503560	critical splice donor site	probably null
R9743:Gria4	UTSW	9	4464457	missense	probably damaging	1.00
X0023:Gria4	UTSW	9	4427067	missense	probably damaging	1.00
X0065:Gria4	UTSW	9	4464340	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GCTTGCTTACCCCATACACAAG -3'
(R):5'- ATGCCTTCTCTGAGTAAAGCACC -3'

Sequencing Primer
(F):5'- TGCTTACCCCATACACAAGCTCTC -3'
(R):5'- CTCTGAGTAAAGCACCTTACTTAAC -3'

Posted On

2018-06-22