Mutagenetix > Incidental Mutation

Incidental Mutation 'R6505:Ino80'

523683

Institutional Source

Beutler Lab

Gene Symbol

Ino80

Ensembl Gene

ENSMUSG00000034154

Gene Name

INO80 complex subunit

Synonyms

INO80, 2310079N15Rik, 4632409L19Rik, Inoc1

MMRRC Submission

044637-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.960) question?

Stock #

R6505 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119373042-119477687 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 119451441 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 185 (Y185N)

Ref Sequence

ENSEMBL: ENSMUSP00000106431 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049920] [ENSMUST00000110808]

AlphaFold

Q6ZPV2

Predicted Effect

probably damaging
Transcript: ENSMUST00000049920
AA Change: Y185N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000051845
Gene: ENSMUSG00000034154
AA Change: Y185N

Domain	Start	End	E-Value	Type
coiled coil region	131	165	N/A	INTRINSIC
low complexity region	206	242	N/A	INTRINSIC
Pfam:DBINO	275	407	6.6e-50	PFAM
low complexity region	474	489	N/A	INTRINSIC
DEXDc	516	714	6.27e-37	SMART
low complexity region	907	923	N/A	INTRINSIC
HELICc	1134	1217	2.86e-22	SMART
low complexity region	1270	1324	N/A	INTRINSIC
low complexity region	1357	1368	N/A	INTRINSIC
low complexity region	1424	1436	N/A	INTRINSIC
low complexity region	1438	1450	N/A	INTRINSIC
low complexity region	1457	1483	N/A	INTRINSIC
low complexity region	1510	1521	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000110808
AA Change: Y185N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106431
Gene: ENSMUSG00000034154
AA Change: Y185N

Domain	Start	End	E-Value	Type
coiled coil region	131	165	N/A	INTRINSIC
low complexity region	206	242	N/A	INTRINSIC
Pfam:DBINO	272	412	8.8e-55	PFAM
low complexity region	474	489	N/A	INTRINSIC
DEXDc	516	714	6.27e-37	SMART
low complexity region	907	923	N/A	INTRINSIC
PDB:3MWY\|W	1098	1136	6e-7	PDB

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

100% (84/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the chromatin remodeling complex, which is classified into subfamilies depending on sequence features apart from the conserved ATPase domain. This protein is the catalytic ATPase subunit of the INO80 chromatin remodeling complex, which is characterized by a DNA-binding domain. This protein is proposed to bind DNA and be recruited by the YY1 transcription factor to activate certain genes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
PHENOTYPE: Embryos homozygous for a knock-out allele die around E7.5 and show absence of anterior and distal visceral endoderm. Another null allele results in embryonic lethality by E13.5-E14.5 with severe growth retardation and developmental defects. Heterozygotes show defects in hindlimb extension reflex. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700010I14Rik	A	T	17: 9,001,940	I424L	probably benign	Het
2610028H24Rik	C	T	10: 76,449,281	A8V	probably benign	Het
Ago1	G	A	4: 126,463,835	P16S	probably benign	Het
Ak5	C	T	3: 152,481,669	E394K	probably benign	Het
Aldh7a1	T	C	18: 56,526,996	Y498C	probably damaging	Het
Alox12	T	A	11: 70,250,204	D335V	probably damaging	Het
Alx4	A	T	2: 93,668,559	Y212F	probably damaging	Het
Asb16	A	G	11: 102,276,477	E223G	probably damaging	Het
Atg9b	C	T	5: 24,390,577	V235M	probably damaging	Het
BB014433	A	G	8: 15,042,304	V183A	probably benign	Het
Brca1	T	A	11: 101,523,541	M1256L	probably benign	Het
Bst1	A	G	5: 43,820,590	I94V	probably benign	Het
C3ar1	A	G	6: 122,850,640	L206P	probably benign	Het
Cabs1	T	A	5: 87,980,663	M391K	possibly damaging	Het
Cars	C	T	7: 143,565,007	R599Q	probably damaging	Het
Ccdc190	T	A	1: 169,933,023	Y73*	probably null	Het
Cd177	A	C	7: 24,744,246	L809W	probably benign	Het
Cemip	C	A	7: 83,951,597	G939*	probably null	Het
Clca3b	T	A	3: 144,825,259	I777F	probably benign	Het
Cma2	T	C	14: 55,973,779	I176T	probably damaging	Het
Col12a1	T	A	9: 79,647,605	T2064S	probably damaging	Het
Csf1r	A	G	18: 61,129,733	N860S	probably damaging	Het
Dab1	T	A	4: 104,512,264	C3S	probably benign	Het
Dennd4b	A	G	3: 90,267,611	E50G	probably damaging	Het
Dis3l	A	T	9: 64,307,513	S925T	probably benign	Het
Disp1	T	C	1: 183,086,512	N1448S	probably benign	Het
Dpp10	T	C	1: 123,336,851	I747M	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Ephx4	A	T	5: 107,403,656	K36*	probably null	Het
Fam135a	C	T	1: 24,014,872	V1195I	probably damaging	Het
Fap	A	T	2: 62,546,603	Y234*	probably null	Het
Fem1c	A	T	18: 46,505,875	N353K	possibly damaging	Het
Furin	C	A	7: 80,393,617	R282L	probably damaging	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm5930	A	G	14: 44,331,371	*265Q	probably null	Het
Hcrtr1	T	A	4: 130,137,586	T15S	probably benign	Het
Ifnar1	C	T	16: 91,499,537	Q309*	probably null	Het
Il18r1	A	T	1: 40,489,707	I304L	probably benign	Het
Itgb2	G	A	10: 77,559,673	C536Y	probably damaging	Het
Ivns1abp	T	C	1: 151,360,993	M435T	probably benign	Het
Kcnh4	T	C	11: 100,757,085	N151D	probably benign	Het
Lama3	T	C	18: 12,495,348	M1499T	probably benign	Het
Lamb1	A	T	12: 31,323,462	T1397S	possibly damaging	Het
Leng1	G	A	7: 3,661,212	R239*	probably null	Het
Map2k4	A	T	11: 65,693,529	N309K	possibly damaging	Het
Mcm3	A	G	1: 20,803,544	F784S	probably damaging	Het
Mrgpra9	T	A	7: 47,235,136	N260I	probably benign	Het
Mrnip	C	A	11: 50,199,852	T281N	possibly damaging	Het
Myo9b	A	G	8: 71,355,857	T1715A	possibly damaging	Het
Nectin3	A	G	16: 46,448,821	I406T	possibly damaging	Het
Neto1	A	G	18: 86,498,574	T339A	possibly damaging	Het
Ntn1	T	C	11: 68,213,199	D541G	probably damaging	Het
Nuak2	C	A	1: 132,316,394	H55Q	probably damaging	Het
Nufip2	A	G	11: 77,691,613	T118A	probably benign	Het
Olfr1126	T	A	2: 87,457,927	V254E	probably damaging	Het
Olfr1155	A	T	2: 87,943,174	Y151*	probably null	Het
Olfr19	A	T	16: 16,673,920	D20E	probably benign	Het
Olfr213	C	T	6: 116,540,600	T49M	probably benign	Het
Olfr266	T	G	3: 106,822,322	N79T	possibly damaging	Het
Olfr483	T	C	7: 108,103,567	V86A	probably benign	Het
Olfr596	C	A	7: 103,309,793	A24D	probably benign	Het
Olfr609	T	A	7: 103,492,651	T76S	probably damaging	Het
Olfr847	T	C	9: 19,374,941	*313W	probably null	Het
Pcdhb5	T	A	18: 37,320,880	H104Q	probably benign	Het
Phf11a	T	C	14: 59,277,537	R232G	probably damaging	Het
Pik3r5	C	T	11: 68,492,789	T478I	probably benign	Het
Prkacb	T	A	3: 146,732,646	E380V	probably damaging	Het
Prl7c1	G	T	13: 27,773,793	D221E	probably damaging	Het
Prr11	T	A	11: 87,106,124	K5*	probably null	Het
Prrc2b	G	A	2: 32,222,320	G1932D	probably damaging	Het
Rexo1	A	T	10: 80,543,011	Y1064N	possibly damaging	Het
Rnf182	C	T	13: 43,668,671	Q233*	probably null	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Sash1	C	G	10: 8,729,527	G1033A	probably benign	Het
Sncaip	C	A	18: 52,906,537	S189*	probably null	Het
Sorl1	T	C	9: 42,071,234	Y350C	probably damaging	Het
Speg	T	C	1: 75,406,684	V1141A	possibly damaging	Het
Speg	C	A	1: 75,429,523	D3091E	possibly damaging	Het
Sucnr1	A	T	3: 60,086,723	D224V	probably benign	Het
Tg	G	A	15: 66,759,558	A559T	probably damaging	Het
Tmem132d	A	G	5: 127,784,438	I873T	probably benign	Het
Tmem229a	C	T	6: 24,954,921	C278Y	probably damaging	Het
Togaram1	T	C	12: 64,966,590	I205T	possibly damaging	Het
Usp19	T	A	9: 108,496,883	L713Q	probably damaging	Het
Vsig10	A	G	5: 117,351,759	D530G	possibly damaging	Het
Zfp106	A	G	2: 120,534,502	S475P	probably damaging	Het

Other mutations in Ino80

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01404:Ino80	APN	2	119456718	missense	possibly damaging	0.83
IGL01985:Ino80	APN	2	119433321	missense	probably damaging	0.99
IGL02039:Ino80	APN	2	119380073	missense	probably damaging	1.00
IGL02187:Ino80	APN	2	119445457	splice site	probably benign
IGL02726:Ino80	APN	2	119442483	missense	probably damaging	1.00
Chosen	UTSW	2	119382269	splice site	probably null
PIT4677001:Ino80	UTSW	2	119377545	missense	probably benign
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0004:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0057:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0113:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0114:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0115:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0138:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0189:Ino80	UTSW	2	119379679	missense	probably benign	0.36
R0363:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0364:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0365:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0481:Ino80	UTSW	2	119431016	missense	probably damaging	1.00
R0532:Ino80	UTSW	2	119381983	missense	possibly damaging	0.79
R0580:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R0610:Ino80	UTSW	2	119382960	missense	probably damaging	1.00
R0675:Ino80	UTSW	2	119383481	missense	probably damaging	1.00
R1275:Ino80	UTSW	2	119427055	missense	probably benign	0.12
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1470:Ino80	UTSW	2	119379649	missense	probably damaging	1.00
R1506:Ino80	UTSW	2	119425265	nonsense	probably null
R1510:Ino80	UTSW	2	119450049	missense	probably damaging	1.00
R1570:Ino80	UTSW	2	119447028	missense	possibly damaging	0.68
R1613:Ino80	UTSW	2	119392867	missense	probably damaging	1.00
R1673:Ino80	UTSW	2	119381936	missense	probably damaging	1.00
R1773:Ino80	UTSW	2	119418409	missense	probably benign	0.18
R1795:Ino80	UTSW	2	119406859	missense	probably damaging	1.00
R2093:Ino80	UTSW	2	119426670	missense	possibly damaging	0.55
R2105:Ino80	UTSW	2	119431929	missense	probably null	1.00
R2113:Ino80	UTSW	2	119454084	missense	probably damaging	1.00
R3618:Ino80	UTSW	2	119446872	missense	probably null	0.81
R4572:Ino80	UTSW	2	119402358	missense	probably damaging	1.00
R4649:Ino80	UTSW	2	119431008	missense	probably damaging	1.00
R4919:Ino80	UTSW	2	119442592	missense	probably damaging	1.00
R5113:Ino80	UTSW	2	119431945	missense	probably damaging	1.00
R5138:Ino80	UTSW	2	119383421	missense	probably damaging	1.00
R5458:Ino80	UTSW	2	119412429	missense	possibly damaging	0.50
R5499:Ino80	UTSW	2	119441647	missense	probably damaging	1.00
R5502:Ino80	UTSW	2	119402396	missense	probably damaging	1.00
R5531:Ino80	UTSW	2	119445575	missense	probably benign
R5740:Ino80	UTSW	2	119431029	missense	probably damaging	1.00
R5892:Ino80	UTSW	2	119439547	intron	probably benign
R5914:Ino80	UTSW	2	119458216	missense	probably damaging	0.99
R6000:Ino80	UTSW	2	119374508	missense	probably benign	0.04
R6263:Ino80	UTSW	2	119383414	missense	probably damaging	1.00
R6942:Ino80	UTSW	2	119383502	missense	probably damaging	0.99
R7052:Ino80	UTSW	2	119426587	critical splice donor site	probably null
R7100:Ino80	UTSW	2	119374513	missense	possibly damaging	0.47
R7163:Ino80	UTSW	2	119392875	missense	probably damaging	1.00
R7187:Ino80	UTSW	2	119426591	missense	probably benign	0.00
R7202:Ino80	UTSW	2	119374437	missense	probably benign	0.00
R7218:Ino80	UTSW	2	119458127	missense	probably benign
R7389:Ino80	UTSW	2	119442529	missense	probably benign	0.00
R7419:Ino80	UTSW	2	119380014	missense	probably benign	0.00
R7437:Ino80	UTSW	2	119442586	missense	possibly damaging	0.86
R7607:Ino80	UTSW	2	119382269	splice site	probably null
R7702:Ino80	UTSW	2	119442573	missense	probably benign	0.01
R7975:Ino80	UTSW	2	119456467	splice site	probably null
R7978:Ino80	UTSW	2	119439393	missense	possibly damaging	0.93
R8376:Ino80	UTSW	2	119442487	missense	probably benign	0.14
R8469:Ino80	UTSW	2	119379593	missense	probably benign
R8720:Ino80	UTSW	2	119402387	missense	probably damaging	1.00
R8751:Ino80	UTSW	2	119406908	missense	probably benign
R8958:Ino80	UTSW	2	119383381	missense	probably damaging	1.00
R8992:Ino80	UTSW	2	119379578	missense	possibly damaging	0.93
R9319:Ino80	UTSW	2	119374524	missense	probably benign	0.13
R9346:Ino80	UTSW	2	119426958	missense	possibly damaging	0.54
R9370:Ino80	UTSW	2	119402367	missense	probably damaging	1.00
R9621:Ino80	UTSW	2	119450015	missense	probably damaging	0.98
R9641:Ino80	UTSW	2	119445484	missense	probably benign	0.08
R9650:Ino80	UTSW	2	119446983	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTAAACCTTTGTGTAGCAACC -3'
(R):5'- TTGTGCATAGCAGTTGATCCTG -3'

Sequencing Primer
(F):5'- AGGTAGACTCAGCCTCTATGTAGC -3'
(R):5'- GCATAGCAGTTGATCCTGTTTTAC -3'

Posted On

2018-06-22