Incidental Mutation 'R6612:Kcnc2'
ID523692
Institutional Source Beutler Lab
Gene Symbol Kcnc2
Ensembl Gene ENSMUSG00000035681
Gene Namepotassium voltage gated channel, Shaw-related subfamily, member 2
SynonymsKv3.2, KShIIIA
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6612 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location112271121-112467024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 112271856 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 51 (G51R)
Ref Sequence ENSEMBL: ENSMUSP00000151579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092175] [ENSMUST00000219301]
Predicted Effect probably benign
Transcript: ENSMUST00000092175
AA Change: G51R

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000089814
Gene: ENSMUSG00000035681
AA Change: G51R

DomainStartEndE-ValueType
BTB 8 163 2.53e-17 SMART
Pfam:Ion_trans 232 488 1e-46 PFAM
Pfam:Ion_trans_2 388 481 5.8e-13 PFAM
low complexity region 552 568 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219301
AA Change: G51R

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
Meta Mutation Damage Score 0.1030 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.4%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to one of these subfamilies, namely the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired fast spiking in cortical interneurons, distorted cortical rhythmic activity, enhanced susceptibility to seizures, increased anxiety in the open field, and abnormal sleep patterns. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,007 D320E possibly damaging Het
4930523C07Rik A C 1: 160,075,234 N25H probably damaging Het
Akr1c14 A T 13: 4,065,331 S87C probably benign Het
Arhgef37 T C 18: 61,494,881 T664A probably benign Het
Arsi A G 18: 60,912,456 T73A probably benign Het
Cacnb2 A T 2: 14,975,149 T274S probably benign Het
Cd244 A G 1: 171,574,104 T133A probably benign Het
Ciz1 T A 2: 32,377,311 S720T possibly damaging Het
Cxcr6 T A 9: 123,810,720 I262N probably damaging Het
Cyp2a4 T A 7: 26,308,647 F160I probably benign Het
Esrra T C 19: 6,911,852 T390A probably benign Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Gm17079 C A 14: 51,694,375 Q91H probably damaging Het
Gm17079 T A 14: 51,694,376 Q91L possibly damaging Het
Got1 A G 19: 43,504,803 S256P probably damaging Het
Gria4 C T 9: 4,472,206 V428I possibly damaging Het
Grin2b A G 6: 135,740,998 Y699H probably damaging Het
Hipk2 T C 6: 38,818,873 I154V probably benign Het
Hkdc1 T C 10: 62,395,441 E628G possibly damaging Het
Hmcn1 C G 1: 150,595,118 probably null Het
Hspbap1 T G 16: 35,801,591 L102W probably damaging Het
Iqcb1 G A 16: 36,871,661 probably benign Het
Itga7 A G 10: 128,948,993 Y763C possibly damaging Het
Itgb4 A T 11: 115,984,071 D418V probably benign Het
Jakmip2 T C 18: 43,557,367 D631G probably damaging Het
Kcnu1 A G 8: 25,918,316 I52V probably benign Het
Kdm5a T C 6: 120,430,228 I1468T probably damaging Het
Kmt2d A G 15: 98,845,858 probably benign Het
Mab21l3 A G 3: 101,818,645 V345A possibly damaging Het
March10 A T 11: 105,397,078 S133T probably damaging Het
Mccc1 T C 3: 35,993,930 S115G probably benign Het
Mchr1 G A 15: 81,237,870 V274M probably damaging Het
Mrgpra3 T A 7: 47,590,035 I48F probably benign Het
Myo9a T A 9: 59,827,196 F687Y probably damaging Het
Nfrkb T A 9: 31,397,006 L216* probably null Het
Nrxn3 A T 12: 89,813,332 probably benign Het
Olfr746 A T 14: 50,653,633 Y132F probably damaging Het
Olig2 T A 16: 91,226,881 M161K probably damaging Het
Pcdh15 T A 10: 74,185,378 N141K probably damaging Het
Pcdha4 T C 18: 36,954,978 V738A probably benign Het
Pdgfra T C 5: 75,167,842 S212P probably benign Het
Plk3 G A 4: 117,132,737 Q194* probably null Het
Ppp1r36 T C 12: 76,437,604 I216T possibly damaging Het
Ptprz1 T A 6: 23,052,082 N2303K probably damaging Het
Rab25 G A 3: 88,543,403 T117M probably damaging Het
Slc25a47 T C 12: 108,855,978 V231A probably benign Het
Slx4 G A 16: 3,985,276 H1225Y probably damaging Het
Snx13 C T 12: 35,106,759 A470V probably benign Het
Spa17 A G 9: 37,605,794 F101S probably benign Het
Ssh1 C T 5: 113,958,730 A217T probably benign Het
Synm G C 7: 67,733,516 T1466S probably damaging Het
Tbc1d19 A G 5: 53,809,845 E29G possibly damaging Het
Teddm2 T A 1: 153,850,445 T175S probably benign Het
Tet2 T A 3: 133,487,335 H446L possibly damaging Het
Tmem110 T A 14: 30,871,564 probably null Het
Tpm3-rs7 G T 14: 113,314,836 R54L probably benign Het
Ttc5 T A 14: 50,785,469 probably null Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Ush2a T C 1: 188,911,397 S4319P possibly damaging Het
Zbtb10 C A 3: 9,252,065 H312Q possibly damaging Het
Zfp462 A T 4: 55,012,324 probably null Het
Other mutations in Kcnc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Kcnc2 APN 10 112461988 missense probably damaging 0.99
IGL00595:Kcnc2 APN 10 112461987 missense probably benign 0.04
IGL01646:Kcnc2 APN 10 112272406 critical splice donor site probably null
IGL01950:Kcnc2 APN 10 112462075 intron probably benign
IGL02036:Kcnc2 APN 10 112455926 missense possibly damaging 0.94
IGL02164:Kcnc2 APN 10 112455685 missense possibly damaging 0.92
IGL02447:Kcnc2 APN 10 112455946 missense probably damaging 1.00
IGL03087:Kcnc2 APN 10 112455747 missense probably benign 0.19
IGL03385:Kcnc2 APN 10 112455786 missense probably damaging 1.00
R0133:Kcnc2 UTSW 10 112458597 missense probably damaging 1.00
R1444:Kcnc2 UTSW 10 112455601 unclassified probably benign
R1474:Kcnc2 UTSW 10 112456400 missense probably damaging 1.00
R2221:Kcnc2 UTSW 10 112456526 missense probably damaging 1.00
R4504:Kcnc2 UTSW 10 112455794 missense probably damaging 1.00
R4714:Kcnc2 UTSW 10 112455828 missense possibly damaging 0.82
R4935:Kcnc2 UTSW 10 112272228 missense probably benign 0.00
R6168:Kcnc2 UTSW 10 112455756 missense probably benign 0.13
R6338:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6375:Kcnc2 UTSW 10 112463189 missense possibly damaging 0.92
R6511:Kcnc2 UTSW 10 112462067 intron probably benign
R6516:Kcnc2 UTSW 10 112462000 missense probably benign 0.00
R6556:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6609:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6610:Kcnc2 UTSW 10 112271856 missense probably benign 0.04
R6837:Kcnc2 UTSW 10 112458502 missense probably damaging 0.96
R7151:Kcnc2 UTSW 10 112458509 missense possibly damaging 0.46
R7715:Kcnc2 UTSW 10 112271940 nonsense probably null
Z1177:Kcnc2 UTSW 10 112272306 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCCCTAGTCATGTCTGAGC -3'
(R):5'- CCGTGCGGTAGTAATTGAGCAC -3'

Sequencing Primer
(F):5'- CTAGTCATGTCTGAGCCACAG -3'
(R):5'- TTGAGCACATAGGCGAATACTCCTG -3'
Posted On2018-06-22