Incidental Mutation 'R6505:Clca3b'
ID 523693
Institutional Source Beutler Lab
Gene Symbol Clca3b
Ensembl Gene ENSMUSG00000037033
Gene Name chloride channel accessory 3B
Synonyms Clca4
MMRRC Submission 044637-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.055) question?
Stock # R6505 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 144528384-144555063 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 144531020 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 777 (I777F)
Ref Sequence ENSEMBL: ENSMUSP00000124581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159989]
AlphaFold E9PUL3
Predicted Effect probably benign
Transcript: ENSMUST00000159989
AA Change: I777F

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124581
Gene: ENSMUSG00000037033
AA Change: I777F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 481 6.22e-19 SMART
FN3 762 861 4.93e0 SMART
low complexity region 880 1025 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (84/84)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,220,772 (GRCm39) I424L probably benign Het
2610028H24Rik C T 10: 76,285,115 (GRCm39) A8V probably benign Het
Ago1 G A 4: 126,357,628 (GRCm39) P16S probably benign Het
Ak5 C T 3: 152,187,306 (GRCm39) E394K probably benign Het
Aldh7a1 T C 18: 56,660,068 (GRCm39) Y498C probably damaging Het
Alox12 T A 11: 70,141,030 (GRCm39) D335V probably damaging Het
Alx4 A T 2: 93,498,904 (GRCm39) Y212F probably damaging Het
Asb16 A G 11: 102,167,303 (GRCm39) E223G probably damaging Het
Atg9b C T 5: 24,595,575 (GRCm39) V235M probably damaging Het
BB014433 A G 8: 15,092,304 (GRCm39) V183A probably benign Het
Brca1 T A 11: 101,414,367 (GRCm39) M1256L probably benign Het
Bst1 A G 5: 43,977,932 (GRCm39) I94V probably benign Het
C3ar1 A G 6: 122,827,599 (GRCm39) L206P probably benign Het
Cabs1 T A 5: 88,128,522 (GRCm39) M391K possibly damaging Het
Cars1 C T 7: 143,118,744 (GRCm39) R599Q probably damaging Het
Ccdc190 T A 1: 169,760,592 (GRCm39) Y73* probably null Het
Cd177 A C 7: 24,443,671 (GRCm39) L809W probably benign Het
Cemip C A 7: 83,600,805 (GRCm39) G939* probably null Het
Cma2 T C 14: 56,211,236 (GRCm39) I176T probably damaging Het
Col12a1 T A 9: 79,554,887 (GRCm39) T2064S probably damaging Het
Csf1r A G 18: 61,262,805 (GRCm39) N860S probably damaging Het
Dab1 T A 4: 104,369,461 (GRCm39) C3S probably benign Het
Dennd4b A G 3: 90,174,918 (GRCm39) E50G probably damaging Het
Dis3l A T 9: 64,214,795 (GRCm39) S925T probably benign Het
Disp1 T C 1: 182,868,076 (GRCm39) N1448S probably benign Het
Dpp10 T C 1: 123,264,580 (GRCm39) I747M probably damaging Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Ephx4 A T 5: 107,551,522 (GRCm39) K36* probably null Het
Fam135a C T 1: 24,053,953 (GRCm39) V1195I probably damaging Het
Fap A T 2: 62,376,947 (GRCm39) Y234* probably null Het
Fem1c A T 18: 46,638,942 (GRCm39) N353K possibly damaging Het
Furin C A 7: 80,043,365 (GRCm39) R282L probably damaging Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm5930 A G 14: 44,568,828 (GRCm39) *265Q probably null Het
Hcrtr1 T A 4: 130,031,379 (GRCm39) T15S probably benign Het
Ifnar1 C T 16: 91,296,425 (GRCm39) Q309* probably null Het
Il18r1 A T 1: 40,528,867 (GRCm39) I304L probably benign Het
Ino80 A T 2: 119,281,922 (GRCm39) Y185N probably damaging Het
Itgb2 G A 10: 77,395,507 (GRCm39) C536Y probably damaging Het
Ivns1abp T C 1: 151,236,744 (GRCm39) M435T probably benign Het
Kcnh4 T C 11: 100,647,911 (GRCm39) N151D probably benign Het
Lama3 T C 18: 12,628,405 (GRCm39) M1499T probably benign Het
Lamb1 A T 12: 31,373,461 (GRCm39) T1397S possibly damaging Het
Leng1 G A 7: 3,664,211 (GRCm39) R239* probably null Het
Map2k4 A T 11: 65,584,355 (GRCm39) N309K possibly damaging Het
Mcm3 A G 1: 20,873,768 (GRCm39) F784S probably damaging Het
Mrgpra9 T A 7: 46,884,884 (GRCm39) N260I probably benign Het
Mrnip C A 11: 50,090,679 (GRCm39) T281N possibly damaging Het
Myo9b A G 8: 71,808,501 (GRCm39) T1715A possibly damaging Het
Nectin3 A G 16: 46,269,184 (GRCm39) I406T possibly damaging Het
Neto1 A G 18: 86,516,699 (GRCm39) T339A possibly damaging Het
Ntn1 T C 11: 68,104,025 (GRCm39) D541G probably damaging Het
Nuak2 C A 1: 132,244,132 (GRCm39) H55Q probably damaging Het
Nufip2 A G 11: 77,582,439 (GRCm39) T118A probably benign Het
Or11i1 T G 3: 106,729,638 (GRCm39) N79T possibly damaging Het
Or12e7 T A 2: 87,288,271 (GRCm39) V254E probably damaging Het
Or51af1 T A 7: 103,141,858 (GRCm39) T76S probably damaging Het
Or52e19 C A 7: 102,959,000 (GRCm39) A24D probably benign Het
Or5d16 A T 2: 87,773,518 (GRCm39) Y151* probably null Het
Or5p59 T C 7: 107,702,774 (GRCm39) V86A probably benign Het
Or6d13 C T 6: 116,517,561 (GRCm39) T49M probably benign Het
Or7a40 A T 16: 16,491,784 (GRCm39) D20E probably benign Het
Or7g29 T C 9: 19,286,237 (GRCm39) *313W probably null Het
Pcdhb5 T A 18: 37,453,933 (GRCm39) H104Q probably benign Het
Phf11a T C 14: 59,514,986 (GRCm39) R232G probably damaging Het
Pik3r5 C T 11: 68,383,615 (GRCm39) T478I probably benign Het
Prkacb T A 3: 146,438,401 (GRCm39) E380V probably damaging Het
Prl7c1 G T 13: 27,957,776 (GRCm39) D221E probably damaging Het
Prr11 T A 11: 86,996,950 (GRCm39) K5* probably null Het
Prrc2b G A 2: 32,112,332 (GRCm39) G1932D probably damaging Het
Rexo1 A T 10: 80,378,845 (GRCm39) Y1064N possibly damaging Het
Rnf182 C T 13: 43,822,147 (GRCm39) Q233* probably null Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sash1 C G 10: 8,605,291 (GRCm39) G1033A probably benign Het
Sncaip C A 18: 53,039,609 (GRCm39) S189* probably null Het
Sorl1 T C 9: 41,982,530 (GRCm39) Y350C probably damaging Het
Speg T C 1: 75,383,328 (GRCm39) V1141A possibly damaging Het
Speg C A 1: 75,406,167 (GRCm39) D3091E possibly damaging Het
Sucnr1 A T 3: 59,994,144 (GRCm39) D224V probably benign Het
Tg G A 15: 66,631,407 (GRCm39) A559T probably damaging Het
Tmem132d A G 5: 127,861,502 (GRCm39) I873T probably benign Het
Tmem229a C T 6: 24,954,920 (GRCm39) C278Y probably damaging Het
Togaram1 T C 12: 65,013,364 (GRCm39) I205T possibly damaging Het
Usp19 T A 9: 108,374,082 (GRCm39) L713Q probably damaging Het
Vsig10 A G 5: 117,489,824 (GRCm39) D530G possibly damaging Het
Zfp106 A G 2: 120,364,983 (GRCm39) S475P probably damaging Het
Other mutations in Clca3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Clca3b APN 3 144,542,393 (GRCm39) missense probably damaging 0.96
IGL00425:Clca3b APN 3 144,542,342 (GRCm39) missense probably benign 0.14
IGL00725:Clca3b APN 3 144,544,923 (GRCm39) missense probably benign 0.01
IGL00898:Clca3b APN 3 144,550,389 (GRCm39) splice site probably benign
IGL00953:Clca3b APN 3 144,552,972 (GRCm39) nonsense probably null
IGL01089:Clca3b APN 3 144,529,283 (GRCm39) missense probably benign
IGL01376:Clca3b APN 3 144,531,812 (GRCm39) missense possibly damaging 0.60
IGL01996:Clca3b APN 3 144,554,924 (GRCm39) missense probably benign 0.04
IGL02022:Clca3b APN 3 144,547,171 (GRCm39) critical splice donor site probably null
IGL02200:Clca3b APN 3 144,547,190 (GRCm39) missense probably damaging 1.00
IGL02314:Clca3b APN 3 144,533,903 (GRCm39) splice site probably benign
IGL02331:Clca3b APN 3 144,547,167 (GRCm39) splice site probably benign
IGL02429:Clca3b APN 3 144,533,896 (GRCm39) missense probably damaging 1.00
IGL02868:Clca3b APN 3 144,533,325 (GRCm39) missense probably damaging 1.00
IGL03095:Clca3b APN 3 144,552,671 (GRCm39) nonsense probably null
IGL03331:Clca3b APN 3 144,533,724 (GRCm39) missense probably benign
R0242:Clca3b UTSW 3 144,547,226 (GRCm39) missense probably benign 0.00
R0242:Clca3b UTSW 3 144,547,226 (GRCm39) missense probably benign 0.00
R0506:Clca3b UTSW 3 144,528,627 (GRCm39) unclassified probably benign
R0524:Clca3b UTSW 3 144,531,082 (GRCm39) missense probably benign
R0637:Clca3b UTSW 3 144,533,701 (GRCm39) missense probably benign 0.03
R1577:Clca3b UTSW 3 144,529,280 (GRCm39) missense probably damaging 1.00
R1641:Clca3b UTSW 3 144,529,274 (GRCm39) missense possibly damaging 0.53
R1680:Clca3b UTSW 3 144,543,585 (GRCm39) missense probably damaging 1.00
R2240:Clca3b UTSW 3 144,531,696 (GRCm39) missense probably benign 0.22
R2248:Clca3b UTSW 3 144,530,980 (GRCm39) missense probably benign 0.01
R2259:Clca3b UTSW 3 144,552,142 (GRCm39) missense possibly damaging 0.80
R2920:Clca3b UTSW 3 144,552,692 (GRCm39) missense probably benign 0.01
R2920:Clca3b UTSW 3 144,543,614 (GRCm39) missense probably benign 0.31
R4355:Clca3b UTSW 3 144,531,219 (GRCm39) splice site probably null
R4691:Clca3b UTSW 3 144,544,853 (GRCm39) missense probably benign 0.02
R4828:Clca3b UTSW 3 144,550,273 (GRCm39) missense probably benign 0.02
R4845:Clca3b UTSW 3 144,531,031 (GRCm39) missense probably benign
R5182:Clca3b UTSW 3 144,533,776 (GRCm39) missense probably damaging 0.99
R5396:Clca3b UTSW 3 144,552,932 (GRCm39) missense probably damaging 0.99
R5429:Clca3b UTSW 3 144,552,220 (GRCm39) missense probably damaging 1.00
R5572:Clca3b UTSW 3 144,533,070 (GRCm39) missense probably damaging 1.00
R5657:Clca3b UTSW 3 144,533,144 (GRCm39) missense probably benign 0.25
R5845:Clca3b UTSW 3 144,531,077 (GRCm39) missense possibly damaging 0.46
R6677:Clca3b UTSW 3 144,529,145 (GRCm39) missense probably benign 0.13
R6707:Clca3b UTSW 3 144,550,288 (GRCm39) missense probably benign 0.00
R7001:Clca3b UTSW 3 144,533,733 (GRCm39) missense possibly damaging 0.48
R7285:Clca3b UTSW 3 144,543,519 (GRCm39) missense probably benign 0.00
R7323:Clca3b UTSW 3 144,531,681 (GRCm39) missense possibly damaging 0.60
R7324:Clca3b UTSW 3 144,547,181 (GRCm39) missense possibly damaging 0.81
R7334:Clca3b UTSW 3 144,542,417 (GRCm39) nonsense probably null
R7403:Clca3b UTSW 3 144,529,259 (GRCm39) missense probably benign 0.00
R7798:Clca3b UTSW 3 144,533,891 (GRCm39) missense probably damaging 1.00
R8008:Clca3b UTSW 3 144,550,370 (GRCm39) missense probably benign 0.44
R8132:Clca3b UTSW 3 144,552,935 (GRCm39) missense probably benign 0.13
R8181:Clca3b UTSW 3 144,544,898 (GRCm39) missense probably benign 0.00
R8305:Clca3b UTSW 3 144,531,698 (GRCm39) missense probably damaging 1.00
R8546:Clca3b UTSW 3 144,533,158 (GRCm39) missense probably damaging 0.99
R8716:Clca3b UTSW 3 144,550,355 (GRCm39) missense probably benign 0.14
R8804:Clca3b UTSW 3 144,544,898 (GRCm39) missense probably benign 0.00
R8966:Clca3b UTSW 3 144,544,872 (GRCm39) missense probably benign 0.27
R9003:Clca3b UTSW 3 144,533,072 (GRCm39) nonsense probably null
R9455:Clca3b UTSW 3 144,529,023 (GRCm39) missense unknown
R9470:Clca3b UTSW 3 144,543,456 (GRCm39) missense probably damaging 1.00
R9658:Clca3b UTSW 3 144,543,575 (GRCm39) missense probably damaging 0.98
R9760:Clca3b UTSW 3 144,552,610 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGCCAGCTTGTATCTTTTGAAG -3'
(R):5'- TTGTACTGAATCCACCCAGAC -3'

Sequencing Primer
(F):5'- CCAGCTTGTATCTTTTGAAGTTTCAG -3'
(R):5'- GACCGGAAATCCCAGAAGC -3'
Posted On 2018-06-22