Incidental Mutation 'R6505:Dab1'
ID523699
Institutional Source Beutler Lab
Gene Symbol Dab1
Ensembl Gene ENSMUSG00000028519
Gene Namedisabled 1
SynonymsC630028C02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.866) question?
Stock #R6505 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location103619359-104744844 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 104512264 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 3 (C3S)
Ref Sequence ENSEMBL: ENSMUSP00000102439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106826] [ENSMUST00000106827] [ENSMUST00000106830] [ENSMUST00000143644] [ENSMUST00000146078]
Predicted Effect probably benign
Transcript: ENSMUST00000106826
AA Change: C3S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000102439
Gene: ENSMUSG00000028519
AA Change: C3S

DomainStartEndE-ValueType
PTB 17 151 3.51e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106827
SMART Domains Protein: ENSMUSP00000102440
Gene: ENSMUSG00000028519

DomainStartEndE-ValueType
PTB 37 171 3.51e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106830
SMART Domains Protein: ENSMUSP00000102443
Gene: ENSMUSG00000028519

DomainStartEndE-ValueType
PTB 37 171 3.51e-36 SMART
low complexity region 254 267 N/A INTRINSIC
low complexity region 470 487 N/A INTRINSIC
low complexity region 490 501 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143644
SMART Domains Protein: ENSMUSP00000118650
Gene: ENSMUSG00000028519

DomainStartEndE-ValueType
PTB 37 160 5.54e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146078
SMART Domains Protein: ENSMUSP00000125033
Gene: ENSMUSG00000028519

DomainStartEndE-ValueType
PTB 37 171 3.51e-36 SMART
low complexity region 235 242 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The laminar organization of multiple neuronal types in the cerebral cortex is required for normal cognitive function. In mice, the disabled-1 gene plays a central role in brain development, directing the migration of cortical neurons past previously formed neurons to reach their proper layer. This gene is similar to disabled-1, and the protein encoded by this gene is thought to be a signal transducer that interacts with protein kinase pathways to regulate neuronal positioning in the developing brain. [provided by RefSeq, Jan 2017]
PHENOTYPE: Homozygous null display unstable gait and whole-body tremor with a hypoplastic cerebellum devoid of folia, a probable consequence of defective neuronal migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,001,940 I424L probably benign Het
2610028H24Rik C T 10: 76,449,281 A8V probably benign Het
Ago1 G A 4: 126,463,835 P16S probably benign Het
Ak5 C T 3: 152,481,669 E394K probably benign Het
Aldh7a1 T C 18: 56,526,996 Y498C probably damaging Het
Alox12 T A 11: 70,250,204 D335V probably damaging Het
Alx4 A T 2: 93,668,559 Y212F probably damaging Het
Asb16 A G 11: 102,276,477 E223G probably damaging Het
Atg9b C T 5: 24,390,577 V235M probably damaging Het
BB014433 A G 8: 15,042,304 V183A probably benign Het
Brca1 T A 11: 101,523,541 M1256L probably benign Het
Bst1 A G 5: 43,820,590 I94V probably benign Het
C3ar1 A G 6: 122,850,640 L206P probably benign Het
Cabs1 T A 5: 87,980,663 M391K possibly damaging Het
Cars C T 7: 143,565,007 R599Q probably damaging Het
Ccdc190 T A 1: 169,933,023 Y73* probably null Het
Cd177 A C 7: 24,744,246 L809W probably benign Het
Cemip C A 7: 83,951,597 G939* probably null Het
Clca3b T A 3: 144,825,259 I777F probably benign Het
Cma2 T C 14: 55,973,779 I176T probably damaging Het
Col12a1 T A 9: 79,647,605 T2064S probably damaging Het
Csf1r A G 18: 61,129,733 N860S probably damaging Het
Dennd4b A G 3: 90,267,611 E50G probably damaging Het
Dis3l A T 9: 64,307,513 S925T probably benign Het
Disp1 T C 1: 183,086,512 N1448S probably benign Het
Dpp10 T C 1: 123,336,851 I747M probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ephx4 A T 5: 107,403,656 K36* probably null Het
Fam135a C T 1: 24,014,872 V1195I probably damaging Het
Fap A T 2: 62,546,603 Y234* probably null Het
Fem1c A T 18: 46,505,875 N353K possibly damaging Het
Furin C A 7: 80,393,617 R282L probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5930 A G 14: 44,331,371 *265Q probably null Het
Hcrtr1 T A 4: 130,137,586 T15S probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Il18r1 A T 1: 40,489,707 I304L probably benign Het
Ino80 A T 2: 119,451,441 Y185N probably damaging Het
Itgb2 G A 10: 77,559,673 C536Y probably damaging Het
Ivns1abp T C 1: 151,360,993 M435T probably benign Het
Kcnh4 T C 11: 100,757,085 N151D probably benign Het
Lama3 T C 18: 12,495,348 M1499T probably benign Het
Lamb1 A T 12: 31,323,462 T1397S possibly damaging Het
Leng1 G A 7: 3,661,212 R239* probably null Het
Map2k4 A T 11: 65,693,529 N309K possibly damaging Het
Mcm3 A G 1: 20,803,544 F784S probably damaging Het
Mrgpra9 T A 7: 47,235,136 N260I probably benign Het
Mrnip C A 11: 50,199,852 T281N possibly damaging Het
Myo9b A G 8: 71,355,857 T1715A possibly damaging Het
Nectin3 A G 16: 46,448,821 I406T possibly damaging Het
Neto1 A G 18: 86,498,574 T339A possibly damaging Het
Ntn1 T C 11: 68,213,199 D541G probably damaging Het
Nuak2 C A 1: 132,316,394 H55Q probably damaging Het
Nufip2 A G 11: 77,691,613 T118A probably benign Het
Olfr1126 T A 2: 87,457,927 V254E probably damaging Het
Olfr1155 A T 2: 87,943,174 Y151* probably null Het
Olfr19 A T 16: 16,673,920 D20E probably benign Het
Olfr213 C T 6: 116,540,600 T49M probably benign Het
Olfr266 T G 3: 106,822,322 N79T possibly damaging Het
Olfr483 T C 7: 108,103,567 V86A probably benign Het
Olfr596 C A 7: 103,309,793 A24D probably benign Het
Olfr609 T A 7: 103,492,651 T76S probably damaging Het
Olfr847 T C 9: 19,374,941 *313W probably null Het
Pcdhb5 T A 18: 37,320,880 H104Q probably benign Het
Phf11a T C 14: 59,277,537 R232G probably damaging Het
Pik3r5 C T 11: 68,492,789 T478I probably benign Het
Prkacb T A 3: 146,732,646 E380V probably damaging Het
Prl7c1 G T 13: 27,773,793 D221E probably damaging Het
Prr11 T A 11: 87,106,124 K5* probably null Het
Prrc2b G A 2: 32,222,320 G1932D probably damaging Het
Rexo1 A T 10: 80,543,011 Y1064N possibly damaging Het
Rnf182 C T 13: 43,668,671 Q233* probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sash1 C G 10: 8,729,527 G1033A probably benign Het
Sncaip C A 18: 52,906,537 S189* probably null Het
Sorl1 T C 9: 42,071,234 Y350C probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Speg C A 1: 75,429,523 D3091E possibly damaging Het
Sucnr1 A T 3: 60,086,723 D224V probably benign Het
Tg G A 15: 66,759,558 A559T probably damaging Het
Tmem132d A G 5: 127,784,438 I873T probably benign Het
Tmem229a C T 6: 24,954,921 C278Y probably damaging Het
Togaram1 T C 12: 64,966,590 I205T possibly damaging Het
Usp19 T A 9: 108,496,883 L713Q probably damaging Het
Vsig10 A G 5: 117,351,759 D530G possibly damaging Het
Zfp106 A G 2: 120,534,502 S475P probably damaging Het
Other mutations in Dab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Dab1 APN 4 104678810 missense probably damaging 1.00
IGL00087:Dab1 APN 4 104678753 missense possibly damaging 0.90
IGL00328:Dab1 APN 4 104688438 missense possibly damaging 0.55
IGL00756:Dab1 APN 4 104727878 missense probably benign
IGL02074:Dab1 APN 4 104727854 missense possibly damaging 0.90
IGL02286:Dab1 APN 4 104680070 missense probably damaging 1.00
IGL02986:Dab1 APN 4 104479221 missense probably benign 0.00
IGL03008:Dab1 APN 4 104727580 missense probably damaging 0.99
IGL03133:Dab1 APN 4 104727580 missense probably benign 0.41
IGL03375:Dab1 APN 4 104681601 missense possibly damaging 0.70
LCD18:Dab1 UTSW 4 104046572 intron probably benign
R0027:Dab1 UTSW 4 104704199 intron probably benign
R0466:Dab1 UTSW 4 104720550 missense probably benign 0.15
R0838:Dab1 UTSW 4 104731751 missense probably benign 0.29
R0840:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1086:Dab1 UTSW 4 104328572 intron probably benign
R1598:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1640:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1699:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1749:Dab1 UTSW 4 104328298 intron probably benign
R1770:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1846:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1847:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1848:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1885:Dab1 UTSW 4 104731751 missense probably benign 0.29
R1986:Dab1 UTSW 4 104613215 missense probably damaging 0.97
R1990:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2006:Dab1 UTSW 4 104605325 missense probably damaging 1.00
R2030:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2032:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2034:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2061:Dab1 UTSW 4 104678741 missense probably damaging 1.00
R2088:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2089:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2091:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2091:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2092:Dab1 UTSW 4 104678777 missense probably damaging 1.00
R2193:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2194:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2361:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2362:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2391:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2424:Dab1 UTSW 4 104731751 missense probably benign 0.29
R2865:Dab1 UTSW 4 104680146 missense probably benign
R3118:Dab1 UTSW 4 104680069 critical splice acceptor site probably null
R3716:Dab1 UTSW 4 104731751 missense probably benign 0.29
R3718:Dab1 UTSW 4 104731751 missense probably benign 0.29
R3740:Dab1 UTSW 4 104731751 missense probably benign 0.29
R3742:Dab1 UTSW 4 104731751 missense probably benign 0.29
R3965:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4057:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4393:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4396:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4418:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4607:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4608:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4648:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4693:Dab1 UTSW 4 104679553 missense probably damaging 1.00
R4701:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4730:Dab1 UTSW 4 104731751 missense probably benign 0.29
R4760:Dab1 UTSW 4 104732145 missense probably damaging 1.00
R4927:Dab1 UTSW 4 104704252 missense probably benign
R5173:Dab1 UTSW 4 104688448 splice site probably null
R5503:Dab1 UTSW 4 104512264 missense probably benign 0.01
R6199:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6200:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6207:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6224:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6227:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6228:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6229:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6246:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6247:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6248:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6249:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6250:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6258:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6259:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6260:Dab1 UTSW 4 104731751 missense probably benign 0.29
R6817:Dab1 UTSW 4 104679546 missense probably damaging 1.00
R7305:Dab1 UTSW 4 104713790 missense
R7709:Dab1 UTSW 4 104720559 nonsense probably null
R7894:Dab1 UTSW 4 104732138 missense probably benign 0.03
R8142:Dab1 UTSW 4 104678724 missense probably damaging 1.00
RF017:Dab1 UTSW 4 104713652 missense probably benign 0.01
Z1088:Dab1 UTSW 4 104479232 missense probably damaging 0.99
Z1176:Dab1 UTSW 4 104728078 missense probably benign 0.00
Z1177:Dab1 UTSW 4 104727740 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- ATGGCAGTTCAACAGAATTATCAGG -3'
(R):5'- CAGAGGGCTGAAAATACTTGCC -3'

Sequencing Primer
(F):5'- GTTCAACAGAATTATCAGGAATGTTC -3'
(R):5'- GGCTGAAAATACTTGCCACAAAG -3'
Posted On2018-06-22