Incidental Mutation 'R6505:Bst1'
ID523708
Institutional Source Beutler Lab
Gene Symbol Bst1
Ensembl Gene ENSMUSG00000029082
Gene Namebone marrow stromal cell antigen 1
SynonymsBp3, Bsta1, CD157, 114/A10, Ly65
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R6505 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location43818885-43843986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43820590 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 94 (I94V)
Ref Sequence ENSEMBL: ENSMUSP00000098796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101237] [ENSMUST00000114047] [ENSMUST00000126976]
Predicted Effect probably benign
Transcript: ENSMUST00000101237
AA Change: I94V

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000098796
Gene: ENSMUSG00000029082
AA Change: I94V

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Rib_hydrolayse 35 273 5.9e-103 PFAM
low complexity region 277 288 N/A INTRINSIC
low complexity region 295 311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114047
SMART Domains Protein: ENSMUSP00000109681
Gene: ENSMUSG00000039753

DomainStartEndE-ValueType
Pfam:Hemerythrin 19 132 4.4e-11 PFAM
FBOX 202 242 2.31e-9 SMART
low complexity region 283 304 N/A INTRINSIC
LRR 349 373 2.43e2 SMART
LRR 376 401 4.87e-4 SMART
low complexity region 475 486 N/A INTRINSIC
LRR 590 615 2.45e0 SMART
LRR 618 643 4.65e-1 SMART
Blast:LRR 644 675 2e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118126
SMART Domains Protein: ENSMUSP00000113593
Gene: ENSMUSG00000029082

DomainStartEndE-ValueType
Pfam:Rib_hydrolayse 1 164 3.8e-69 PFAM
low complexity region 168 179 N/A INTRINSIC
low complexity region 186 202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126976
SMART Domains Protein: ENSMUSP00000143382
Gene: ENSMUSG00000029082

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
PDB:1ISM|B 28 54 2e-7 PDB
SCOP:d1isia_ 29 56 6e-12 SMART
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bone marrow stromal cell antigen-1 is a stromal cell line-derived glycosylphosphatidylinositol-anchored molecule that facilitates pre-B-cell growth. The deduced amino acid sequence exhibits 33% similarity with CD38. BST1 expression is enhanced in bone marrow stromal cell lines derived from patients with rheumatoid arthritis. The polyclonal B-cell abnormalities in rheumatoid arthritis may be, at least in part, attributed to BST1 overexpression in the stromal cell population. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show delayed peritoneal B-1 cell development and a rise in CD38low/- B-lineage cells in bone marrow and spleen. The systemic thymus-independent-2 antigen-induced IgG3 and mucosal thymus-dependent antigen-elicited IgA responses are selectively impaired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,001,940 I424L probably benign Het
2610028H24Rik C T 10: 76,449,281 A8V probably benign Het
Ago1 G A 4: 126,463,835 P16S probably benign Het
Ak5 C T 3: 152,481,669 E394K probably benign Het
Aldh7a1 T C 18: 56,526,996 Y498C probably damaging Het
Alox12 T A 11: 70,250,204 D335V probably damaging Het
Alx4 A T 2: 93,668,559 Y212F probably damaging Het
Asb16 A G 11: 102,276,477 E223G probably damaging Het
Atg9b C T 5: 24,390,577 V235M probably damaging Het
BB014433 A G 8: 15,042,304 V183A probably benign Het
Brca1 T A 11: 101,523,541 M1256L probably benign Het
C3ar1 A G 6: 122,850,640 L206P probably benign Het
Cabs1 T A 5: 87,980,663 M391K possibly damaging Het
Cars C T 7: 143,565,007 R599Q probably damaging Het
Ccdc190 T A 1: 169,933,023 Y73* probably null Het
Cd177 A C 7: 24,744,246 L809W probably benign Het
Cemip C A 7: 83,951,597 G939* probably null Het
Clca3b T A 3: 144,825,259 I777F probably benign Het
Cma2 T C 14: 55,973,779 I176T probably damaging Het
Col12a1 T A 9: 79,647,605 T2064S probably damaging Het
Csf1r A G 18: 61,129,733 N860S probably damaging Het
Dab1 T A 4: 104,512,264 C3S probably benign Het
Dennd4b A G 3: 90,267,611 E50G probably damaging Het
Dis3l A T 9: 64,307,513 S925T probably benign Het
Disp1 T C 1: 183,086,512 N1448S probably benign Het
Dpp10 T C 1: 123,336,851 I747M probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ephx4 A T 5: 107,403,656 K36* probably null Het
Fam135a C T 1: 24,014,872 V1195I probably damaging Het
Fap A T 2: 62,546,603 Y234* probably null Het
Fem1c A T 18: 46,505,875 N353K possibly damaging Het
Furin C A 7: 80,393,617 R282L probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5930 A G 14: 44,331,371 *265Q probably null Het
Hcrtr1 T A 4: 130,137,586 T15S probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Il18r1 A T 1: 40,489,707 I304L probably benign Het
Ino80 A T 2: 119,451,441 Y185N probably damaging Het
Itgb2 G A 10: 77,559,673 C536Y probably damaging Het
Ivns1abp T C 1: 151,360,993 M435T probably benign Het
Kcnh4 T C 11: 100,757,085 N151D probably benign Het
Lama3 T C 18: 12,495,348 M1499T probably benign Het
Lamb1 A T 12: 31,323,462 T1397S possibly damaging Het
Leng1 G A 7: 3,661,212 R239* probably null Het
Map2k4 A T 11: 65,693,529 N309K possibly damaging Het
Mcm3 A G 1: 20,803,544 F784S probably damaging Het
Mrgpra9 T A 7: 47,235,136 N260I probably benign Het
Mrnip C A 11: 50,199,852 T281N possibly damaging Het
Myo9b A G 8: 71,355,857 T1715A possibly damaging Het
Nectin3 A G 16: 46,448,821 I406T possibly damaging Het
Neto1 A G 18: 86,498,574 T339A possibly damaging Het
Ntn1 T C 11: 68,213,199 D541G probably damaging Het
Nuak2 C A 1: 132,316,394 H55Q probably damaging Het
Nufip2 A G 11: 77,691,613 T118A probably benign Het
Olfr1126 T A 2: 87,457,927 V254E probably damaging Het
Olfr1155 A T 2: 87,943,174 Y151* probably null Het
Olfr19 A T 16: 16,673,920 D20E probably benign Het
Olfr213 C T 6: 116,540,600 T49M probably benign Het
Olfr266 T G 3: 106,822,322 N79T possibly damaging Het
Olfr483 T C 7: 108,103,567 V86A probably benign Het
Olfr596 C A 7: 103,309,793 A24D probably benign Het
Olfr609 T A 7: 103,492,651 T76S probably damaging Het
Olfr847 T C 9: 19,374,941 *313W probably null Het
Pcdhb5 T A 18: 37,320,880 H104Q probably benign Het
Phf11a T C 14: 59,277,537 R232G probably damaging Het
Pik3r5 C T 11: 68,492,789 T478I probably benign Het
Prkacb T A 3: 146,732,646 E380V probably damaging Het
Prl7c1 G T 13: 27,773,793 D221E probably damaging Het
Prr11 T A 11: 87,106,124 K5* probably null Het
Prrc2b G A 2: 32,222,320 G1932D probably damaging Het
Rexo1 A T 10: 80,543,011 Y1064N possibly damaging Het
Rnf182 C T 13: 43,668,671 Q233* probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sash1 C G 10: 8,729,527 G1033A probably benign Het
Sncaip C A 18: 52,906,537 S189* probably null Het
Sorl1 T C 9: 42,071,234 Y350C probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Speg C A 1: 75,429,523 D3091E possibly damaging Het
Sucnr1 A T 3: 60,086,723 D224V probably benign Het
Tg G A 15: 66,759,558 A559T probably damaging Het
Tmem132d A G 5: 127,784,438 I873T probably benign Het
Tmem229a C T 6: 24,954,921 C278Y probably damaging Het
Togaram1 T C 12: 64,966,590 I205T possibly damaging Het
Usp19 T A 9: 108,496,883 L713Q probably damaging Het
Vsig10 A G 5: 117,351,759 D530G possibly damaging Het
Zfp106 A G 2: 120,534,502 S475P probably damaging Het
Other mutations in Bst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01906:Bst1 APN 5 43837519 missense probably damaging 0.98
IGL02146:Bst1 APN 5 43826336 missense probably damaging 1.00
IGL03008:Bst1 APN 5 43826262 critical splice acceptor site probably null
ossobuco UTSW 5 43820590 missense probably benign 0.04
R0145:Bst1 UTSW 5 43819072 missense probably damaging 1.00
R1158:Bst1 UTSW 5 43840492 critical splice donor site probably null
R1172:Bst1 UTSW 5 43825408 splice site probably null
R3926:Bst1 UTSW 5 43840454 missense possibly damaging 0.81
R4438:Bst1 UTSW 5 43825340 splice site probably null
R4622:Bst1 UTSW 5 43818919 utr 5 prime probably benign
R4852:Bst1 UTSW 5 43820525 missense probably benign 0.16
R4936:Bst1 UTSW 5 43840457 missense probably damaging 0.97
R6048:Bst1 UTSW 5 43818964 intron probably benign
R7442:Bst1 UTSW 5 43821742 missense probably benign 0.00
R7643:Bst1 UTSW 5 43840449 missense probably benign 0.02
Z1177:Bst1 UTSW 5 43819032 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGAGAGGAAGACAGCCTACTC -3'
(R):5'- CCAGGAACAGAAGGATTTCAATACG -3'

Sequencing Primer
(F):5'- CCACCTAATACAATGCTGGGGTTAG -3'
(R):5'- GTTATTTGCTTAGTTCATTGACCAGC -3'
Posted On2018-06-22