Incidental Mutation 'R6505:Vsig10'
ID 523713
Institutional Source Beutler Lab
Gene Symbol Vsig10
Ensembl Gene ENSMUSG00000066894
Gene Name V-set and immunoglobulin domain containing 10
Synonyms
MMRRC Submission 044637-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R6505 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 117457331-117493071 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 117489824 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 530 (D530G)
Ref Sequence ENSEMBL: ENSMUSP00000107598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086464] [ENSMUST00000111967]
AlphaFold D3YX43
Predicted Effect possibly damaging
Transcript: ENSMUST00000086464
AA Change: D503G

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083655
Gene: ENSMUSG00000066894
AA Change: D503G

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
IG 23 114 4.03e-8 SMART
IG 132 214 9.49e-5 SMART
Pfam:Ig_2 215 300 2.6e-2 PFAM
Pfam:Ig_3 216 284 3.5e-4 PFAM
IGc2 313 384 1.12e-6 SMART
transmembrane domain 403 425 N/A INTRINSIC
coiled coil region 446 481 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111967
AA Change: D530G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107598
Gene: ENSMUSG00000066894
AA Change: D530G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IG 50 141 4.03e-8 SMART
IG 159 241 9.49e-5 SMART
Blast:IG_like 248 327 2e-33 BLAST
IGc2 340 411 1.12e-6 SMART
transmembrane domain 430 452 N/A INTRINSIC
coiled coil region 473 508 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139026
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147182
SMART Domains Protein: ENSMUSP00000125808
Gene: ENSMUSG00000066894

DomainStartEndE-ValueType
Blast:IG_like 1 41 3e-14 BLAST
IGc2 54 125 1.12e-6 SMART
transmembrane domain 144 166 N/A INTRINSIC
coiled coil region 187 222 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (84/84)
Allele List at MGI

All alleles(11) : Gene trapped(11)

Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,220,772 (GRCm39) I424L probably benign Het
2610028H24Rik C T 10: 76,285,115 (GRCm39) A8V probably benign Het
Ago1 G A 4: 126,357,628 (GRCm39) P16S probably benign Het
Ak5 C T 3: 152,187,306 (GRCm39) E394K probably benign Het
Aldh7a1 T C 18: 56,660,068 (GRCm39) Y498C probably damaging Het
Alox12 T A 11: 70,141,030 (GRCm39) D335V probably damaging Het
Alx4 A T 2: 93,498,904 (GRCm39) Y212F probably damaging Het
Asb16 A G 11: 102,167,303 (GRCm39) E223G probably damaging Het
Atg9b C T 5: 24,595,575 (GRCm39) V235M probably damaging Het
BB014433 A G 8: 15,092,304 (GRCm39) V183A probably benign Het
Brca1 T A 11: 101,414,367 (GRCm39) M1256L probably benign Het
Bst1 A G 5: 43,977,932 (GRCm39) I94V probably benign Het
C3ar1 A G 6: 122,827,599 (GRCm39) L206P probably benign Het
Cabs1 T A 5: 88,128,522 (GRCm39) M391K possibly damaging Het
Cars1 C T 7: 143,118,744 (GRCm39) R599Q probably damaging Het
Ccdc190 T A 1: 169,760,592 (GRCm39) Y73* probably null Het
Cd177 A C 7: 24,443,671 (GRCm39) L809W probably benign Het
Cemip C A 7: 83,600,805 (GRCm39) G939* probably null Het
Clca3b T A 3: 144,531,020 (GRCm39) I777F probably benign Het
Cma2 T C 14: 56,211,236 (GRCm39) I176T probably damaging Het
Col12a1 T A 9: 79,554,887 (GRCm39) T2064S probably damaging Het
Csf1r A G 18: 61,262,805 (GRCm39) N860S probably damaging Het
Dab1 T A 4: 104,369,461 (GRCm39) C3S probably benign Het
Dennd4b A G 3: 90,174,918 (GRCm39) E50G probably damaging Het
Dis3l A T 9: 64,214,795 (GRCm39) S925T probably benign Het
Disp1 T C 1: 182,868,076 (GRCm39) N1448S probably benign Het
Dpp10 T C 1: 123,264,580 (GRCm39) I747M probably damaging Het
Enpp5 G A 17: 44,396,155 (GRCm39) G356S probably damaging Het
Ephx4 A T 5: 107,551,522 (GRCm39) K36* probably null Het
Fam135a C T 1: 24,053,953 (GRCm39) V1195I probably damaging Het
Fap A T 2: 62,376,947 (GRCm39) Y234* probably null Het
Fem1c A T 18: 46,638,942 (GRCm39) N353K possibly damaging Het
Furin C A 7: 80,043,365 (GRCm39) R282L probably damaging Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm5930 A G 14: 44,568,828 (GRCm39) *265Q probably null Het
Hcrtr1 T A 4: 130,031,379 (GRCm39) T15S probably benign Het
Ifnar1 C T 16: 91,296,425 (GRCm39) Q309* probably null Het
Il18r1 A T 1: 40,528,867 (GRCm39) I304L probably benign Het
Ino80 A T 2: 119,281,922 (GRCm39) Y185N probably damaging Het
Itgb2 G A 10: 77,395,507 (GRCm39) C536Y probably damaging Het
Ivns1abp T C 1: 151,236,744 (GRCm39) M435T probably benign Het
Kcnh4 T C 11: 100,647,911 (GRCm39) N151D probably benign Het
Lama3 T C 18: 12,628,405 (GRCm39) M1499T probably benign Het
Lamb1 A T 12: 31,373,461 (GRCm39) T1397S possibly damaging Het
Leng1 G A 7: 3,664,211 (GRCm39) R239* probably null Het
Map2k4 A T 11: 65,584,355 (GRCm39) N309K possibly damaging Het
Mcm3 A G 1: 20,873,768 (GRCm39) F784S probably damaging Het
Mrgpra9 T A 7: 46,884,884 (GRCm39) N260I probably benign Het
Mrnip C A 11: 50,090,679 (GRCm39) T281N possibly damaging Het
Myo9b A G 8: 71,808,501 (GRCm39) T1715A possibly damaging Het
Nectin3 A G 16: 46,269,184 (GRCm39) I406T possibly damaging Het
Neto1 A G 18: 86,516,699 (GRCm39) T339A possibly damaging Het
Ntn1 T C 11: 68,104,025 (GRCm39) D541G probably damaging Het
Nuak2 C A 1: 132,244,132 (GRCm39) H55Q probably damaging Het
Nufip2 A G 11: 77,582,439 (GRCm39) T118A probably benign Het
Or11i1 T G 3: 106,729,638 (GRCm39) N79T possibly damaging Het
Or12e7 T A 2: 87,288,271 (GRCm39) V254E probably damaging Het
Or51af1 T A 7: 103,141,858 (GRCm39) T76S probably damaging Het
Or52e19 C A 7: 102,959,000 (GRCm39) A24D probably benign Het
Or5d16 A T 2: 87,773,518 (GRCm39) Y151* probably null Het
Or5p59 T C 7: 107,702,774 (GRCm39) V86A probably benign Het
Or6d13 C T 6: 116,517,561 (GRCm39) T49M probably benign Het
Or7a40 A T 16: 16,491,784 (GRCm39) D20E probably benign Het
Or7g29 T C 9: 19,286,237 (GRCm39) *313W probably null Het
Pcdhb5 T A 18: 37,453,933 (GRCm39) H104Q probably benign Het
Phf11a T C 14: 59,514,986 (GRCm39) R232G probably damaging Het
Pik3r5 C T 11: 68,383,615 (GRCm39) T478I probably benign Het
Prkacb T A 3: 146,438,401 (GRCm39) E380V probably damaging Het
Prl7c1 G T 13: 27,957,776 (GRCm39) D221E probably damaging Het
Prr11 T A 11: 86,996,950 (GRCm39) K5* probably null Het
Prrc2b G A 2: 32,112,332 (GRCm39) G1932D probably damaging Het
Rexo1 A T 10: 80,378,845 (GRCm39) Y1064N possibly damaging Het
Rnf182 C T 13: 43,822,147 (GRCm39) Q233* probably null Het
Rsf1 G A 7: 97,229,117 (GRCm39) probably benign Het
Sash1 C G 10: 8,605,291 (GRCm39) G1033A probably benign Het
Sncaip C A 18: 53,039,609 (GRCm39) S189* probably null Het
Sorl1 T C 9: 41,982,530 (GRCm39) Y350C probably damaging Het
Speg T C 1: 75,383,328 (GRCm39) V1141A possibly damaging Het
Speg C A 1: 75,406,167 (GRCm39) D3091E possibly damaging Het
Sucnr1 A T 3: 59,994,144 (GRCm39) D224V probably benign Het
Tg G A 15: 66,631,407 (GRCm39) A559T probably damaging Het
Tmem132d A G 5: 127,861,502 (GRCm39) I873T probably benign Het
Tmem229a C T 6: 24,954,920 (GRCm39) C278Y probably damaging Het
Togaram1 T C 12: 65,013,364 (GRCm39) I205T possibly damaging Het
Usp19 T A 9: 108,374,082 (GRCm39) L713Q probably damaging Het
Zfp106 A G 2: 120,364,983 (GRCm39) S475P probably damaging Het
Other mutations in Vsig10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Vsig10 APN 5 117,476,479 (GRCm39) missense probably benign 0.00
IGL00340:Vsig10 APN 5 117,489,652 (GRCm39) missense probably benign 0.03
IGL01082:Vsig10 APN 5 117,472,970 (GRCm39) missense probably benign 0.33
IGL01285:Vsig10 APN 5 117,462,954 (GRCm39) missense probably benign 0.43
IGL01790:Vsig10 APN 5 117,476,379 (GRCm39) missense probably damaging 1.00
IGL03004:Vsig10 APN 5 117,463,140 (GRCm39) missense probably damaging 1.00
D3080:Vsig10 UTSW 5 117,481,884 (GRCm39) missense probably damaging 1.00
R0101:Vsig10 UTSW 5 117,473,134 (GRCm39) critical splice donor site probably null
R0403:Vsig10 UTSW 5 117,476,526 (GRCm39) missense probably benign 0.05
R0674:Vsig10 UTSW 5 117,481,911 (GRCm39) missense probably damaging 1.00
R1437:Vsig10 UTSW 5 117,489,635 (GRCm39) missense probably damaging 0.96
R1689:Vsig10 UTSW 5 117,490,825 (GRCm39) missense probably benign 0.00
R1710:Vsig10 UTSW 5 117,489,719 (GRCm39) missense probably benign
R1765:Vsig10 UTSW 5 117,456,880 (GRCm39) unclassified probably benign
R4422:Vsig10 UTSW 5 117,462,986 (GRCm39) missense probably benign 0.00
R4541:Vsig10 UTSW 5 117,490,881 (GRCm39) utr 3 prime probably benign
R4909:Vsig10 UTSW 5 117,476,308 (GRCm39) missense probably benign 0.31
R4999:Vsig10 UTSW 5 117,482,040 (GRCm39) missense probably damaging 1.00
R5855:Vsig10 UTSW 5 117,476,335 (GRCm39) missense probably damaging 1.00
R5866:Vsig10 UTSW 5 117,490,814 (GRCm39) critical splice acceptor site probably null
R6214:Vsig10 UTSW 5 117,481,989 (GRCm39) missense probably damaging 1.00
R6418:Vsig10 UTSW 5 117,486,361 (GRCm39) missense probably benign 0.03
R6854:Vsig10 UTSW 5 117,476,472 (GRCm39) missense probably benign 0.36
R7121:Vsig10 UTSW 5 117,481,967 (GRCm39) missense probably damaging 1.00
R7596:Vsig10 UTSW 5 117,472,848 (GRCm39) missense possibly damaging 0.46
R8066:Vsig10 UTSW 5 117,489,849 (GRCm39) missense probably benign 0.00
R8335:Vsig10 UTSW 5 117,486,435 (GRCm39) missense probably damaging 1.00
R8787:Vsig10 UTSW 5 117,472,981 (GRCm39) missense probably benign 0.18
R9026:Vsig10 UTSW 5 117,476,323 (GRCm39) missense probably benign 0.00
R9257:Vsig10 UTSW 5 117,463,131 (GRCm39) missense probably benign 0.29
R9386:Vsig10 UTSW 5 117,463,140 (GRCm39) missense probably damaging 1.00
R9474:Vsig10 UTSW 5 117,463,104 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCCTTTGGAAATTAGGGGACAG -3'
(R):5'- CGGAATGGAGCACTCAACTTAG -3'

Sequencing Primer
(F):5'- CTTTGGAAATTAGGGGACAGGACATG -3'
(R):5'- CACTCAACTTAGCATGGAGTCTTGG -3'
Posted On 2018-06-22