Incidental Mutation 'R6612:Hspbap1'
ID523727
Institutional Source Beutler Lab
Gene Symbol Hspbap1
Ensembl Gene ENSMUSG00000022849
Gene NameHspb associated protein 1
Synonyms3830421G21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6612 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location35770375-35828477 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 35801591 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Tryptophan at position 102 (L102W)
Ref Sequence ENSEMBL: ENSMUSP00000156217 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023555] [ENSMUST00000231579]
Predicted Effect probably damaging
Transcript: ENSMUST00000023555
AA Change: L102W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023555
Gene: ENSMUSG00000022849
AA Change: L102W

DomainStartEndE-ValueType
JmjC 126 288 1.29e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180485
Predicted Effect probably damaging
Transcript: ENSMUST00000231579
AA Change: L102W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231802
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.4%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds to one of the small heat shock proteins, specifically hsp27. Hsp27 is involved with cell growth and differentiation. This encoded protein was found to be abnormally expressed in patients with intractable epilepsy, although how brain function is affected remains unknown. [provided by RefSeq, Sep 2011]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,007 D320E possibly damaging Het
4930523C07Rik A C 1: 160,075,234 N25H probably damaging Het
Akr1c14 A T 13: 4,065,331 S87C probably benign Het
Arhgef37 T C 18: 61,494,881 T664A probably benign Het
Arsi A G 18: 60,912,456 T73A probably benign Het
Cacnb2 A T 2: 14,975,149 T274S probably benign Het
Cd244 A G 1: 171,574,104 T133A probably benign Het
Ciz1 T A 2: 32,377,311 S720T possibly damaging Het
Cxcr6 T A 9: 123,810,720 I262N probably damaging Het
Cyp2a4 T A 7: 26,308,647 F160I probably benign Het
Esrra T C 19: 6,911,852 T390A probably benign Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Gm17079 C A 14: 51,694,375 Q91H probably damaging Het
Gm17079 T A 14: 51,694,376 Q91L possibly damaging Het
Got1 A G 19: 43,504,803 S256P probably damaging Het
Gria4 C T 9: 4,472,206 V428I possibly damaging Het
Grin2b A G 6: 135,740,998 Y699H probably damaging Het
Hipk2 T C 6: 38,818,873 I154V probably benign Het
Hkdc1 T C 10: 62,395,441 E628G possibly damaging Het
Hmcn1 C G 1: 150,595,118 probably null Het
Iqcb1 G A 16: 36,871,661 probably benign Het
Itga7 A G 10: 128,948,993 Y763C possibly damaging Het
Itgb4 A T 11: 115,984,071 D418V probably benign Het
Jakmip2 T C 18: 43,557,367 D631G probably damaging Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Kcnu1 A G 8: 25,918,316 I52V probably benign Het
Kdm5a T C 6: 120,430,228 I1468T probably damaging Het
Kmt2d A G 15: 98,845,858 probably benign Het
Mab21l3 A G 3: 101,818,645 V345A possibly damaging Het
March10 A T 11: 105,397,078 S133T probably damaging Het
Mccc1 T C 3: 35,993,930 S115G probably benign Het
Mchr1 G A 15: 81,237,870 V274M probably damaging Het
Mrgpra3 T A 7: 47,590,035 I48F probably benign Het
Myo9a T A 9: 59,827,196 F687Y probably damaging Het
Nfrkb T A 9: 31,397,006 L216* probably null Het
Nrxn3 A T 12: 89,813,332 probably benign Het
Olfr746 A T 14: 50,653,633 Y132F probably damaging Het
Olig2 T A 16: 91,226,881 M161K probably damaging Het
Pcdh15 T A 10: 74,185,378 N141K probably damaging Het
Pcdha4 T C 18: 36,954,978 V738A probably benign Het
Pdgfra T C 5: 75,167,842 S212P probably benign Het
Plk3 G A 4: 117,132,737 Q194* probably null Het
Ppp1r36 T C 12: 76,437,604 I216T possibly damaging Het
Ptprz1 T A 6: 23,052,082 N2303K probably damaging Het
Rab25 G A 3: 88,543,403 T117M probably damaging Het
Slc25a47 T C 12: 108,855,978 V231A probably benign Het
Slx4 G A 16: 3,985,276 H1225Y probably damaging Het
Snx13 C T 12: 35,106,759 A470V probably benign Het
Spa17 A G 9: 37,605,794 F101S probably benign Het
Ssh1 C T 5: 113,958,730 A217T probably benign Het
Synm G C 7: 67,733,516 T1466S probably damaging Het
Tbc1d19 A G 5: 53,809,845 E29G possibly damaging Het
Teddm2 T A 1: 153,850,445 T175S probably benign Het
Tet2 T A 3: 133,487,335 H446L possibly damaging Het
Tmem110 T A 14: 30,871,564 probably null Het
Tpm3-rs7 G T 14: 113,314,836 R54L probably benign Het
Ttc5 T A 14: 50,785,469 probably null Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Ush2a T C 1: 188,911,397 S4319P possibly damaging Het
Zbtb10 C A 3: 9,252,065 H312Q possibly damaging Het
Zfp462 A T 4: 55,012,324 probably null Het
Other mutations in Hspbap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00695:Hspbap1 APN 16 35814061 splice site probably benign
IGL01377:Hspbap1 APN 16 35825311 missense possibly damaging 0.48
IGL03070:Hspbap1 APN 16 35818726 missense probably damaging 0.96
R1099:Hspbap1 UTSW 16 35824944 missense probably damaging 0.99
R1346:Hspbap1 UTSW 16 35801665 missense probably damaging 1.00
R1532:Hspbap1 UTSW 16 35825303 missense probably damaging 1.00
R1848:Hspbap1 UTSW 16 35818764 critical splice donor site probably null
R1867:Hspbap1 UTSW 16 35801564 missense possibly damaging 0.77
R4512:Hspbap1 UTSW 16 35787241 missense probably damaging 0.98
R4718:Hspbap1 UTSW 16 35787322 missense probably benign 0.07
R5553:Hspbap1 UTSW 16 35801597 missense probably damaging 1.00
R5590:Hspbap1 UTSW 16 35801663 missense probably damaging 1.00
R6151:Hspbap1 UTSW 16 35817222 missense probably damaging 1.00
R7253:Hspbap1 UTSW 16 35817230 missense unknown
R7314:Hspbap1 UTSW 16 35825171 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCCTTAACCTTAAGAACACATCCG -3'
(R):5'- AACCTGTCAGGGCTCACATG -3'

Sequencing Primer
(F):5'- ACACATCCGTTCTTTTGGTTTTATTG -3'
(R):5'- GTCAGGGCTCACATGAGTACTTAC -3'
Posted On2018-06-22