Incidental Mutation 'R6505:Furin'
ID523729
Institutional Source Beutler Lab
Gene Symbol Furin
Ensembl Gene ENSMUSG00000030530
Gene Namefurin (paired basic amino acid cleaving enzyme)
SynonymsPcsk3, PACE, SPC1, 9130404I01Rik, Fur
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6505 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location80388585-80405436 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 80393617 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 282 (R282L)
Ref Sequence ENSEMBL: ENSMUSP00000113370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107362] [ENSMUST00000120753] [ENSMUST00000122232] [ENSMUST00000135306]
Predicted Effect probably damaging
Transcript: ENSMUST00000107362
AA Change: R282L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102985
Gene: ENSMUSG00000030530
AA Change: R282L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PDB:1KN6|A 27 107 4e-7 PDB
Pfam:Peptidase_S8 148 436 3.2e-62 PFAM
Pfam:P_proprotein 484 570 1.3e-33 PFAM
FU 577 620 4.67e-5 SMART
FU 638 681 2.13e-8 SMART
transmembrane domain 713 735 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120753
AA Change: R282L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113793
Gene: ENSMUSG00000030530
AA Change: R282L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:S8_pro-domain 33 107 5.8e-28 PFAM
Pfam:Peptidase_S8 144 427 9.1e-51 PFAM
Pfam:P_proprotein 484 570 4.4e-32 PFAM
FU 577 620 4.67e-5 SMART
FU 638 681 2.13e-8 SMART
transmembrane domain 713 735 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122232
AA Change: R282L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113370
Gene: ENSMUSG00000030530
AA Change: R282L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
PDB:1KN6|A 27 107 4e-7 PDB
Pfam:Peptidase_S8 148 436 3.2e-62 PFAM
Pfam:P_proprotein 484 570 1.3e-33 PFAM
FU 577 620 4.67e-5 SMART
FU 638 681 2.13e-8 SMART
transmembrane domain 713 735 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135306
SMART Domains Protein: ENSMUSP00000116734
Gene: ENSMUSG00000030530

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
SCOP:d1kn6a_ 30 59 1e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153446
Predicted Effect probably benign
Transcript: ENSMUST00000206352
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: This gene encodes a calcium-dependent serine endoprotease that proteolytically activates different proprotein substrates traversing the secretory pathway. The encoded protein undergoes proteolytic autoactivation during which an N-terminal propeptide is cleaved to generate the mature protein. Mice lacking the encoded protein die at an embryonic stage and display hemodynamic insufficiency, cardiac ventral closure defect, axial rotation defect and abnormal yolk sac vasculature. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous null embryos die at E10.5-E11.5. Embryos homozygous for one knock-out allele show multiple tissue abnormalities including abnormal yolk sac vasculature and chorioallantoic fusion, failure of axial rotation, a kinked neural tube, exencephaly and severe ventral closure and cardiac defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,001,940 I424L probably benign Het
2610028H24Rik C T 10: 76,449,281 A8V probably benign Het
Ago1 G A 4: 126,463,835 P16S probably benign Het
Ak5 C T 3: 152,481,669 E394K probably benign Het
Aldh7a1 T C 18: 56,526,996 Y498C probably damaging Het
Alox12 T A 11: 70,250,204 D335V probably damaging Het
Alx4 A T 2: 93,668,559 Y212F probably damaging Het
Asb16 A G 11: 102,276,477 E223G probably damaging Het
Atg9b C T 5: 24,390,577 V235M probably damaging Het
BB014433 A G 8: 15,042,304 V183A probably benign Het
Brca1 T A 11: 101,523,541 M1256L probably benign Het
Bst1 A G 5: 43,820,590 I94V probably benign Het
C3ar1 A G 6: 122,850,640 L206P probably benign Het
Cabs1 T A 5: 87,980,663 M391K possibly damaging Het
Cars C T 7: 143,565,007 R599Q probably damaging Het
Ccdc190 T A 1: 169,933,023 Y73* probably null Het
Cd177 A C 7: 24,744,246 L809W probably benign Het
Cemip C A 7: 83,951,597 G939* probably null Het
Clca3b T A 3: 144,825,259 I777F probably benign Het
Cma2 T C 14: 55,973,779 I176T probably damaging Het
Col12a1 T A 9: 79,647,605 T2064S probably damaging Het
Csf1r A G 18: 61,129,733 N860S probably damaging Het
Dab1 T A 4: 104,512,264 C3S probably benign Het
Dennd4b A G 3: 90,267,611 E50G probably damaging Het
Dis3l A T 9: 64,307,513 S925T probably benign Het
Disp1 T C 1: 183,086,512 N1448S probably benign Het
Dpp10 T C 1: 123,336,851 I747M probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ephx4 A T 5: 107,403,656 K36* probably null Het
Fam135a C T 1: 24,014,872 V1195I probably damaging Het
Fap A T 2: 62,546,603 Y234* probably null Het
Fem1c A T 18: 46,505,875 N353K possibly damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5930 A G 14: 44,331,371 *265Q probably null Het
Hcrtr1 T A 4: 130,137,586 T15S probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Il18r1 A T 1: 40,489,707 I304L probably benign Het
Ino80 A T 2: 119,451,441 Y185N probably damaging Het
Itgb2 G A 10: 77,559,673 C536Y probably damaging Het
Ivns1abp T C 1: 151,360,993 M435T probably benign Het
Kcnh4 T C 11: 100,757,085 N151D probably benign Het
Lama3 T C 18: 12,495,348 M1499T probably benign Het
Lamb1 A T 12: 31,323,462 T1397S possibly damaging Het
Leng1 G A 7: 3,661,212 R239* probably null Het
Map2k4 A T 11: 65,693,529 N309K possibly damaging Het
Mcm3 A G 1: 20,803,544 F784S probably damaging Het
Mrgpra9 T A 7: 47,235,136 N260I probably benign Het
Mrnip C A 11: 50,199,852 T281N possibly damaging Het
Myo9b A G 8: 71,355,857 T1715A possibly damaging Het
Nectin3 A G 16: 46,448,821 I406T possibly damaging Het
Neto1 A G 18: 86,498,574 T339A possibly damaging Het
Ntn1 T C 11: 68,213,199 D541G probably damaging Het
Nuak2 C A 1: 132,316,394 H55Q probably damaging Het
Nufip2 A G 11: 77,691,613 T118A probably benign Het
Olfr1126 T A 2: 87,457,927 V254E probably damaging Het
Olfr1155 A T 2: 87,943,174 Y151* probably null Het
Olfr19 A T 16: 16,673,920 D20E probably benign Het
Olfr213 C T 6: 116,540,600 T49M probably benign Het
Olfr266 T G 3: 106,822,322 N79T possibly damaging Het
Olfr483 T C 7: 108,103,567 V86A probably benign Het
Olfr596 C A 7: 103,309,793 A24D probably benign Het
Olfr609 T A 7: 103,492,651 T76S probably damaging Het
Olfr847 T C 9: 19,374,941 *313W probably null Het
Pcdhb5 T A 18: 37,320,880 H104Q probably benign Het
Phf11a T C 14: 59,277,537 R232G probably damaging Het
Pik3r5 C T 11: 68,492,789 T478I probably benign Het
Prkacb T A 3: 146,732,646 E380V probably damaging Het
Prl7c1 G T 13: 27,773,793 D221E probably damaging Het
Prr11 T A 11: 87,106,124 K5* probably null Het
Prrc2b G A 2: 32,222,320 G1932D probably damaging Het
Rexo1 A T 10: 80,543,011 Y1064N possibly damaging Het
Rnf182 C T 13: 43,668,671 Q233* probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sash1 C G 10: 8,729,527 G1033A probably benign Het
Sncaip C A 18: 52,906,537 S189* probably null Het
Sorl1 T C 9: 42,071,234 Y350C probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Speg C A 1: 75,429,523 D3091E possibly damaging Het
Sucnr1 A T 3: 60,086,723 D224V probably benign Het
Tg G A 15: 66,759,558 A559T probably damaging Het
Tmem132d A G 5: 127,784,438 I873T probably benign Het
Tmem229a C T 6: 24,954,921 C278Y probably damaging Het
Togaram1 T C 12: 64,966,590 I205T possibly damaging Het
Usp19 T A 9: 108,496,883 L713Q probably damaging Het
Vsig10 A G 5: 117,351,759 D530G possibly damaging Het
Zfp106 A G 2: 120,534,502 S475P probably damaging Het
Other mutations in Furin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00816:Furin APN 7 80392567 missense probably damaging 1.00
IGL00910:Furin APN 7 80390996 missense probably benign
IGL01701:Furin APN 7 80392492 missense probably benign 0.11
IGL01701:Furin APN 7 80390759 missense probably benign 0.00
IGL01921:Furin APN 7 80395954 unclassified probably benign
IGL01981:Furin APN 7 80392899 missense probably damaging 1.00
IGL02035:Furin APN 7 80390987 missense probably benign
IGL02096:Furin APN 7 80393459 missense probably damaging 1.00
IGL02508:Furin APN 7 80392521 missense probably benign 0.01
IGL02611:Furin APN 7 80391778 missense probably benign 0.04
R0359:Furin UTSW 7 80391284 missense probably damaging 1.00
R0481:Furin UTSW 7 80393549 missense probably damaging 1.00
R0554:Furin UTSW 7 80391284 missense probably damaging 1.00
R1346:Furin UTSW 7 80392184 unclassified probably benign
R1347:Furin UTSW 7 80392184 unclassified probably benign
R1373:Furin UTSW 7 80392184 unclassified probably benign
R1553:Furin UTSW 7 80398592 splice site probably null
R1693:Furin UTSW 7 80392482 missense probably damaging 1.00
R4524:Furin UTSW 7 80398634 splice site probably null
R4687:Furin UTSW 7 80393447 missense probably benign 0.00
R4869:Furin UTSW 7 80396979 missense probably damaging 1.00
R5249:Furin UTSW 7 80393421 missense probably damaging 1.00
R5498:Furin UTSW 7 80391794 missense probably damaging 1.00
R5708:Furin UTSW 7 80397855 intron probably benign
R6086:Furin UTSW 7 80395431 missense probably damaging 1.00
R6772:Furin UTSW 7 80393492 missense probably damaging 1.00
R6945:Furin UTSW 7 80391090 missense possibly damaging 0.82
R6954:Furin UTSW 7 80396964 missense possibly damaging 0.79
R7396:Furin UTSW 7 80398114 missense probably benign 0.00
R7510:Furin UTSW 7 80393585 missense probably damaging 1.00
R7542:Furin UTSW 7 80393459 missense probably damaging 1.00
R7577:Furin UTSW 7 80396986 missense probably damaging 1.00
R7812:Furin UTSW 7 80395974 missense possibly damaging 0.94
R7995:Furin UTSW 7 80395447 missense probably damaging 1.00
R8351:Furin UTSW 7 80398722 missense probably benign 0.00
R8389:Furin UTSW 7 80390879 missense probably benign 0.00
R8451:Furin UTSW 7 80398722 missense probably benign 0.00
X0050:Furin UTSW 7 80395412 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAAGACTCACGATCTGCTTC -3'
(R):5'- AAGCATTTGGGTGTGAGCC -3'

Sequencing Primer
(F):5'- AAGACTCACGATCTGCTTCTCATTC -3'
(R):5'- AGCCTGGTCTAGTTTGATTTTGTAC -3'
Posted On2018-06-22