Incidental Mutation 'R6505:Cemip'
ID523732
Institutional Source Beutler Lab
Gene Symbol Cemip
Ensembl Gene ENSMUSG00000052353
Gene Namecell migration inducing protein, hyaluronan binding
Synonyms6330404C01Rik, 9930013L23Rik, 12H19.01.T7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6505 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location83932857-84086502 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 83951597 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 939 (G939*)
Ref Sequence ENSEMBL: ENSMUSP00000063277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064174]
Predicted Effect probably null
Transcript: ENSMUST00000064174
AA Change: G939*
SMART Domains Protein: ENSMUSP00000063277
Gene: ENSMUSG00000052353
AA Change: G939*

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
G8 44 166 9.01e-42 SMART
Pfam:ILEI 187 281 2.1e-28 PFAM
Pfam:Mucin2_WxxW 324 403 1.2e-13 PFAM
PbH1 572 594 7.34e3 SMART
PbH1 595 617 3.73e3 SMART
PbH1 719 741 4.11e3 SMART
PbH1 798 819 6.96e2 SMART
Blast:PbH1 844 882 7e-17 BLAST
Blast:PbH1 917 952 2e-15 BLAST
Pfam:ILEI 1244 1334 2.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150495
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 100% (84/84)
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in Schwann cells exhibit transient acceleration of postnatal myelination, reduced demyelination in culture, and reduced myelin degradation and increases remyelination following nerve axotomy or sciatic nerve crush. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,001,940 I424L probably benign Het
2610028H24Rik C T 10: 76,449,281 A8V probably benign Het
Ago1 G A 4: 126,463,835 P16S probably benign Het
Ak5 C T 3: 152,481,669 E394K probably benign Het
Aldh7a1 T C 18: 56,526,996 Y498C probably damaging Het
Alox12 T A 11: 70,250,204 D335V probably damaging Het
Alx4 A T 2: 93,668,559 Y212F probably damaging Het
Asb16 A G 11: 102,276,477 E223G probably damaging Het
Atg9b C T 5: 24,390,577 V235M probably damaging Het
BB014433 A G 8: 15,042,304 V183A probably benign Het
Brca1 T A 11: 101,523,541 M1256L probably benign Het
Bst1 A G 5: 43,820,590 I94V probably benign Het
C3ar1 A G 6: 122,850,640 L206P probably benign Het
Cabs1 T A 5: 87,980,663 M391K possibly damaging Het
Cars C T 7: 143,565,007 R599Q probably damaging Het
Ccdc190 T A 1: 169,933,023 Y73* probably null Het
Cd177 A C 7: 24,744,246 L809W probably benign Het
Clca3b T A 3: 144,825,259 I777F probably benign Het
Cma2 T C 14: 55,973,779 I176T probably damaging Het
Col12a1 T A 9: 79,647,605 T2064S probably damaging Het
Csf1r A G 18: 61,129,733 N860S probably damaging Het
Dab1 T A 4: 104,512,264 C3S probably benign Het
Dennd4b A G 3: 90,267,611 E50G probably damaging Het
Dis3l A T 9: 64,307,513 S925T probably benign Het
Disp1 T C 1: 183,086,512 N1448S probably benign Het
Dpp10 T C 1: 123,336,851 I747M probably damaging Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Ephx4 A T 5: 107,403,656 K36* probably null Het
Fam135a C T 1: 24,014,872 V1195I probably damaging Het
Fap A T 2: 62,546,603 Y234* probably null Het
Fem1c A T 18: 46,505,875 N353K possibly damaging Het
Furin C A 7: 80,393,617 R282L probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5930 A G 14: 44,331,371 *265Q probably null Het
Hcrtr1 T A 4: 130,137,586 T15S probably benign Het
Ifnar1 C T 16: 91,499,537 Q309* probably null Het
Il18r1 A T 1: 40,489,707 I304L probably benign Het
Ino80 A T 2: 119,451,441 Y185N probably damaging Het
Itgb2 G A 10: 77,559,673 C536Y probably damaging Het
Ivns1abp T C 1: 151,360,993 M435T probably benign Het
Kcnh4 T C 11: 100,757,085 N151D probably benign Het
Lama3 T C 18: 12,495,348 M1499T probably benign Het
Lamb1 A T 12: 31,323,462 T1397S possibly damaging Het
Leng1 G A 7: 3,661,212 R239* probably null Het
Map2k4 A T 11: 65,693,529 N309K possibly damaging Het
Mcm3 A G 1: 20,803,544 F784S probably damaging Het
Mrgpra9 T A 7: 47,235,136 N260I probably benign Het
Mrnip C A 11: 50,199,852 T281N possibly damaging Het
Myo9b A G 8: 71,355,857 T1715A possibly damaging Het
Nectin3 A G 16: 46,448,821 I406T possibly damaging Het
Neto1 A G 18: 86,498,574 T339A possibly damaging Het
Ntn1 T C 11: 68,213,199 D541G probably damaging Het
Nuak2 C A 1: 132,316,394 H55Q probably damaging Het
Nufip2 A G 11: 77,691,613 T118A probably benign Het
Olfr1126 T A 2: 87,457,927 V254E probably damaging Het
Olfr1155 A T 2: 87,943,174 Y151* probably null Het
Olfr19 A T 16: 16,673,920 D20E probably benign Het
Olfr213 C T 6: 116,540,600 T49M probably benign Het
Olfr266 T G 3: 106,822,322 N79T possibly damaging Het
Olfr483 T C 7: 108,103,567 V86A probably benign Het
Olfr596 C A 7: 103,309,793 A24D probably benign Het
Olfr609 T A 7: 103,492,651 T76S probably damaging Het
Olfr847 T C 9: 19,374,941 *313W probably null Het
Pcdhb5 T A 18: 37,320,880 H104Q probably benign Het
Phf11a T C 14: 59,277,537 R232G probably damaging Het
Pik3r5 C T 11: 68,492,789 T478I probably benign Het
Prkacb T A 3: 146,732,646 E380V probably damaging Het
Prl7c1 G T 13: 27,773,793 D221E probably damaging Het
Prr11 T A 11: 87,106,124 K5* probably null Het
Prrc2b G A 2: 32,222,320 G1932D probably damaging Het
Rexo1 A T 10: 80,543,011 Y1064N possibly damaging Het
Rnf182 C T 13: 43,668,671 Q233* probably null Het
Rsf1 G A 7: 97,579,910 probably benign Het
Sash1 C G 10: 8,729,527 G1033A probably benign Het
Sncaip C A 18: 52,906,537 S189* probably null Het
Sorl1 T C 9: 42,071,234 Y350C probably damaging Het
Speg T C 1: 75,406,684 V1141A possibly damaging Het
Speg C A 1: 75,429,523 D3091E possibly damaging Het
Sucnr1 A T 3: 60,086,723 D224V probably benign Het
Tg G A 15: 66,759,558 A559T probably damaging Het
Tmem132d A G 5: 127,784,438 I873T probably benign Het
Tmem229a C T 6: 24,954,921 C278Y probably damaging Het
Togaram1 T C 12: 64,966,590 I205T possibly damaging Het
Usp19 T A 9: 108,496,883 L713Q probably damaging Het
Vsig10 A G 5: 117,351,759 D530G possibly damaging Het
Zfp106 A G 2: 120,534,502 S475P probably damaging Het
Other mutations in Cemip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00781:Cemip APN 7 83947280 missense possibly damaging 0.63
IGL01520:Cemip APN 7 83948622 missense probably benign 0.27
IGL01646:Cemip APN 7 83983232 missense possibly damaging 0.81
IGL02057:Cemip APN 7 83987453 missense probably damaging 1.00
IGL02058:Cemip APN 7 83997292 missense probably damaging 0.99
IGL02120:Cemip APN 7 83951563 missense probably damaging 0.99
IGL02278:Cemip APN 7 83937438 missense probably damaging 1.00
IGL02331:Cemip APN 7 83963984 critical splice donor site probably null
IGL02366:Cemip APN 7 83943641 missense probably benign 0.08
IGL02434:Cemip APN 7 83955284 missense probably damaging 0.98
IGL02622:Cemip APN 7 83964175 missense probably damaging 1.00
IGL02958:Cemip APN 7 83975055 missense probably damaging 0.99
IGL02979:Cemip APN 7 84003306 splice site probably benign
IGL03280:Cemip APN 7 83987330 splice site probably benign
IGL03400:Cemip APN 7 83958516 missense probably damaging 0.96
IGL03134:Cemip UTSW 7 83999237 missense probably damaging 1.00
PIT4618001:Cemip UTSW 7 83943939 missense probably benign 0.07
R0149:Cemip UTSW 7 83964010 missense probably benign
R0212:Cemip UTSW 7 83973190 missense probably damaging 0.99
R0361:Cemip UTSW 7 83964010 missense probably benign
R0565:Cemip UTSW 7 83964110 missense probably damaging 0.99
R0727:Cemip UTSW 7 83961578 missense probably benign 0.00
R1342:Cemip UTSW 7 83944075 nonsense probably null
R1456:Cemip UTSW 7 83998510 missense possibly damaging 0.96
R1526:Cemip UTSW 7 83951440 missense probably damaging 1.00
R1676:Cemip UTSW 7 83964038 missense possibly damaging 0.77
R1718:Cemip UTSW 7 83935658 missense probably benign 0.00
R2234:Cemip UTSW 7 83998562 missense probably benign 0.02
R2513:Cemip UTSW 7 83942025 missense probably benign 0.11
R3788:Cemip UTSW 7 83943898 missense probably damaging 1.00
R3964:Cemip UTSW 7 83951509 missense probably benign 0.43
R3966:Cemip UTSW 7 83951509 missense probably benign 0.43
R4436:Cemip UTSW 7 83987429 missense probably null 0.43
R4584:Cemip UTSW 7 83958539 missense probably damaging 1.00
R4601:Cemip UTSW 7 83951618 missense probably damaging 0.98
R4717:Cemip UTSW 7 83947280 missense probably damaging 0.97
R4767:Cemip UTSW 7 83973306 missense probably damaging 1.00
R4822:Cemip UTSW 7 83973241 missense probably benign 0.27
R4849:Cemip UTSW 7 83935737 missense possibly damaging 0.52
R4910:Cemip UTSW 7 83997411 missense probably damaging 1.00
R4911:Cemip UTSW 7 83983253 missense probably damaging 1.00
R4922:Cemip UTSW 7 83947100 intron probably benign
R4924:Cemip UTSW 7 83952938 missense probably damaging 1.00
R5090:Cemip UTSW 7 83942135 missense probably damaging 1.00
R5310:Cemip UTSW 7 83992033 missense probably damaging 1.00
R5327:Cemip UTSW 7 83955301 missense probably damaging 0.99
R5378:Cemip UTSW 7 83958525 missense probably damaging 1.00
R5444:Cemip UTSW 7 83982291 missense probably damaging 0.98
R5644:Cemip UTSW 7 83989184 missense probably benign 0.03
R5688:Cemip UTSW 7 83961641 missense probably damaging 1.00
R5714:Cemip UTSW 7 83975179 missense probably damaging 1.00
R6170:Cemip UTSW 7 83947230 missense possibly damaging 0.89
R6713:Cemip UTSW 7 83943637 missense probably benign 0.03
R6767:Cemip UTSW 7 83998624 missense probably damaging 1.00
R6817:Cemip UTSW 7 83987992 missense probably damaging 1.00
R6896:Cemip UTSW 7 83998576 missense probably damaging 1.00
R6945:Cemip UTSW 7 83998547 missense probably damaging 1.00
R7236:Cemip UTSW 7 83948804 splice site probably null
R7410:Cemip UTSW 7 83952834 missense probably damaging 1.00
R7483:Cemip UTSW 7 83998576 missense probably damaging 0.99
R7734:Cemip UTSW 7 83957664 nonsense probably null
R8005:Cemip UTSW 7 84003408 start gained probably benign
RF008:Cemip UTSW 7 83961635 missense probably damaging 0.99
T0970:Cemip UTSW 7 83983146 missense probably damaging 0.99
X0067:Cemip UTSW 7 83947208 missense probably damaging 0.98
Z1177:Cemip UTSW 7 83947296 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTCTCTGAGTCCTTGTCAC -3'
(R):5'- CCATGCGGTTTCCTCTAGTG -3'

Sequencing Primer
(F):5'- ATAGCGCCCACTGCAGATG -3'
(R):5'- GGTTTCCTCTAGTGCCCAAGG -3'
Posted On2018-06-22