Incidental Mutation 'R6612:Jakmip2'
ID 523735
Institutional Source Beutler Lab
Gene Symbol Jakmip2
Ensembl Gene ENSMUSG00000024502
Gene Name janus kinase and microtubule interacting protein 2
Synonyms 6430702L21Rik, D930046L20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.306) question?
Stock # R6612 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 43531408-43687773 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43557367 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 631 (D631G)
Ref Sequence ENSEMBL: ENSMUSP00000080881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082254]
AlphaFold D3YXK0
Predicted Effect probably damaging
Transcript: ENSMUST00000082254
AA Change: D631G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080881
Gene: ENSMUSG00000024502
AA Change: D631G

DomainStartEndE-ValueType
coiled coil region 13 102 N/A INTRINSIC
coiled coil region 206 249 N/A INTRINSIC
Pfam:JAKMIP_CC3 409 602 2.3e-86 PFAM
coiled coil region 698 808 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.4%
Validation Efficiency 95% (59/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is reported to be a component of the Golgi matrix. It may act as a golgin protein by negatively regulating transit of secretory cargo and by acting as a structural scaffold of the Golgi. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,692,007 D320E possibly damaging Het
4930523C07Rik A C 1: 160,075,234 N25H probably damaging Het
Akr1c14 A T 13: 4,065,331 S87C probably benign Het
Arhgef37 T C 18: 61,494,881 T664A probably benign Het
Arsi A G 18: 60,912,456 T73A probably benign Het
Cacnb2 A T 2: 14,975,149 T274S probably benign Het
Cd244 A G 1: 171,574,104 T133A probably benign Het
Ciz1 T A 2: 32,377,311 S720T possibly damaging Het
Cxcr6 T A 9: 123,810,720 I262N probably damaging Het
Cyp2a4 T A 7: 26,308,647 F160I probably benign Het
Esrra T C 19: 6,911,852 T390A probably benign Het
Fopnl TTGTG TTG 16: 14,300,145 probably null Het
Gm17079 T A 14: 51,694,376 Q91L possibly damaging Het
Gm17079 C A 14: 51,694,375 Q91H probably damaging Het
Got1 A G 19: 43,504,803 S256P probably damaging Het
Gria4 C T 9: 4,472,206 V428I possibly damaging Het
Grin2b A G 6: 135,740,998 Y699H probably damaging Het
Hipk2 T C 6: 38,818,873 I154V probably benign Het
Hkdc1 T C 10: 62,395,441 E628G possibly damaging Het
Hmcn1 C G 1: 150,595,118 probably null Het
Hspbap1 T G 16: 35,801,591 L102W probably damaging Het
Iqcb1 G A 16: 36,871,661 probably benign Het
Itga7 A G 10: 128,948,993 Y763C possibly damaging Het
Itgb4 A T 11: 115,984,071 D418V probably benign Het
Kcnc2 G C 10: 112,271,856 G51R probably benign Het
Kcnu1 A G 8: 25,918,316 I52V probably benign Het
Kdm5a T C 6: 120,430,228 I1468T probably damaging Het
Kmt2d A G 15: 98,845,858 probably benign Het
Mab21l3 A G 3: 101,818,645 V345A possibly damaging Het
March10 A T 11: 105,397,078 S133T probably damaging Het
Mccc1 T C 3: 35,993,930 S115G probably benign Het
Mchr1 G A 15: 81,237,870 V274M probably damaging Het
Mrgpra3 T A 7: 47,590,035 I48F probably benign Het
Myo9a T A 9: 59,827,196 F687Y probably damaging Het
Nfrkb T A 9: 31,397,006 L216* probably null Het
Nrxn3 A T 12: 89,813,332 probably benign Het
Olfr746 A T 14: 50,653,633 Y132F probably damaging Het
Olig2 T A 16: 91,226,881 M161K probably damaging Het
Pcdh15 T A 10: 74,185,378 N141K probably damaging Het
Pcdha4 T C 18: 36,954,978 V738A probably benign Het
Pdgfra T C 5: 75,167,842 S212P probably benign Het
Plk3 G A 4: 117,132,737 Q194* probably null Het
Ppp1r36 T C 12: 76,437,604 I216T possibly damaging Het
Ptprz1 T A 6: 23,052,082 N2303K probably damaging Het
Rab25 G A 3: 88,543,403 T117M probably damaging Het
Slc25a47 T C 12: 108,855,978 V231A probably benign Het
Slx4 G A 16: 3,985,276 H1225Y probably damaging Het
Snx13 C T 12: 35,106,759 A470V probably benign Het
Spa17 A G 9: 37,605,794 F101S probably benign Het
Ssh1 C T 5: 113,958,730 A217T probably benign Het
Synm G C 7: 67,733,516 T1466S probably damaging Het
Tbc1d19 A G 5: 53,809,845 E29G possibly damaging Het
Teddm2 T A 1: 153,850,445 T175S probably benign Het
Tet2 T A 3: 133,487,335 H446L possibly damaging Het
Tmem110 T A 14: 30,871,564 probably null Het
Tpm3-rs7 G T 14: 113,314,836 R54L probably benign Het
Ttc5 T A 14: 50,785,469 probably null Het
Tyk2 G T 9: 21,108,016 Q1014K probably benign Het
Ush2a T C 1: 188,911,397 S4319P possibly damaging Het
Zbtb10 C A 3: 9,252,065 H312Q possibly damaging Het
Zfp462 A T 4: 55,012,324 probably null Het
Other mutations in Jakmip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Jakmip2 APN 18 43590679 utr 5 prime probably benign
IGL01311:Jakmip2 APN 18 43557324 splice site probably benign
IGL01467:Jakmip2 APN 18 43582287 missense probably benign 0.34
IGL01947:Jakmip2 APN 18 43547094 missense probably benign 0.00
IGL02010:Jakmip2 APN 18 43559093 critical splice donor site probably null
IGL02040:Jakmip2 APN 18 43571854 missense probably benign
IGL02143:Jakmip2 APN 18 43563285 missense probably damaging 1.00
IGL02246:Jakmip2 APN 18 43567158 missense possibly damaging 0.82
IGL02350:Jakmip2 APN 18 43547127 missense possibly damaging 0.46
IGL02357:Jakmip2 APN 18 43547127 missense possibly damaging 0.46
IGL02725:Jakmip2 APN 18 43562590 missense probably damaging 0.99
IGL02833:Jakmip2 APN 18 43575451 splice site probably benign
IGL02866:Jakmip2 APN 18 43552201 missense probably benign 0.28
IGL02981:Jakmip2 APN 18 43562530 critical splice donor site probably null
R0042:Jakmip2 UTSW 18 43552145 splice site probably benign
R0044:Jakmip2 UTSW 18 43582105 missense probably benign
R0436:Jakmip2 UTSW 18 43558169 nonsense probably null
R1453:Jakmip2 UTSW 18 43559214 splice site probably null
R1682:Jakmip2 UTSW 18 43581831 critical splice donor site probably null
R1829:Jakmip2 UTSW 18 43582080 missense possibly damaging 0.93
R1908:Jakmip2 UTSW 18 43567144 missense probably benign
R2070:Jakmip2 UTSW 18 43563330 missense probably benign 0.34
R2168:Jakmip2 UTSW 18 43565930 missense probably damaging 1.00
R2985:Jakmip2 UTSW 18 43571181 missense possibly damaging 0.79
R3896:Jakmip2 UTSW 18 43549686 missense probably benign 0.00
R4243:Jakmip2 UTSW 18 43577436 missense probably benign 0.02
R4245:Jakmip2 UTSW 18 43577436 missense probably benign 0.02
R4614:Jakmip2 UTSW 18 43562592 missense probably damaging 1.00
R4687:Jakmip2 UTSW 18 43577412 missense possibly damaging 0.52
R4830:Jakmip2 UTSW 18 43567143 missense probably benign 0.00
R4852:Jakmip2 UTSW 18 43577400 missense probably damaging 0.99
R5099:Jakmip2 UTSW 18 43568108 missense probably benign 0.20
R5381:Jakmip2 UTSW 18 43581960 missense probably damaging 1.00
R5753:Jakmip2 UTSW 18 43559116 missense probably damaging 0.99
R5883:Jakmip2 UTSW 18 43581994 missense possibly damaging 0.59
R6261:Jakmip2 UTSW 18 43575534 missense probably benign 0.01
R6382:Jakmip2 UTSW 18 43571179 missense possibly damaging 0.66
R6527:Jakmip2 UTSW 18 43556524 missense possibly damaging 0.94
R6679:Jakmip2 UTSW 18 43565949 missense probably damaging 0.98
R7070:Jakmip2 UTSW 18 43557328 critical splice donor site probably null
R7103:Jakmip2 UTSW 18 43540583 splice site probably null
R7434:Jakmip2 UTSW 18 43557379 missense possibly damaging 0.94
R7446:Jakmip2 UTSW 18 43577325 missense probably damaging 1.00
R7515:Jakmip2 UTSW 18 43571126 missense probably benign 0.01
R7586:Jakmip2 UTSW 18 43540611 missense probably damaging 0.98
R7720:Jakmip2 UTSW 18 43571908 missense possibly damaging 0.51
R7999:Jakmip2 UTSW 18 43563333 missense probably benign 0.21
R9002:Jakmip2 UTSW 18 43582258 missense probably benign 0.05
R9184:Jakmip2 UTSW 18 43582287 missense probably benign 0.34
R9248:Jakmip2 UTSW 18 43552177 missense probably benign 0.04
R9252:Jakmip2 UTSW 18 43582129 missense possibly damaging 0.92
R9674:Jakmip2 UTSW 18 43571896 missense probably benign
R9691:Jakmip2 UTSW 18 43540620 missense probably damaging 0.99
R9788:Jakmip2 UTSW 18 43571862 missense probably damaging 1.00
X0057:Jakmip2 UTSW 18 43565970 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- AGTTACCTTCCAGCCATTGC -3'
(R):5'- CATGCAAGGCATAAGGACTTC -3'

Sequencing Primer
(F):5'- GCTTGTGGGACTCCCTCTG -3'
(R):5'- CCTCCTGAGGTGGGGCG -3'
Posted On 2018-06-22