Incidental Mutation 'R6613:Ptprt'
ID 523748
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Name protein tyrosine phosphatase receptor type T
Synonyms RPTPrho
MMRRC Submission 044736-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.080) question?
Stock # R6613 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 161363910-162503067 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 161372367 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1435 (V1435A)
Ref Sequence ENSEMBL: ENSMUSP00000105067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000109441
AA Change: V1435A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: V1435A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109442
AA Change: V1434A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: V1434A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109443
AA Change: V1425A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: V1425A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109445
AA Change: V1415A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: V1415A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 G A 6: 125,783,619 (GRCm39) probably null Het
Arfgef1 A T 1: 10,264,621 (GRCm39) I475N possibly damaging Het
Atg16l2 C T 7: 100,939,788 (GRCm39) probably null Het
Atp2c2 T G 8: 120,482,760 (GRCm39) L874R probably damaging Het
C2cd3 T A 7: 100,044,448 (GRCm39) S343R possibly damaging Het
C4b A T 17: 34,952,539 (GRCm39) S1167T probably damaging Het
Cacna1i G A 15: 80,205,460 (GRCm39) G139S probably damaging Het
Chil6 A T 3: 106,297,191 (GRCm39) F317I probably benign Het
Cngb1 A T 8: 95,992,638 (GRCm39) V199E possibly damaging Het
Dcn A T 10: 97,330,902 (GRCm39) T79S probably benign Het
Dcxr A G 11: 120,617,832 (GRCm39) V48A probably benign Het
Dnajc13 A T 9: 104,091,076 (GRCm39) D668E probably benign Het
Dnajc28 C A 16: 91,413,246 (GRCm39) E357* probably null Het
Dock7 A G 4: 98,866,197 (GRCm39) Y1198H probably damaging Het
Flot1 A G 17: 36,136,703 (GRCm39) D167G probably damaging Het
Gpn1 T C 5: 31,654,696 (GRCm39) probably null Het
Hyou1 A T 9: 44,293,795 (GRCm39) I242F probably damaging Het
Igfbpl1 T C 4: 45,813,447 (GRCm39) N256S probably benign Het
Kif20b C T 19: 34,914,384 (GRCm39) Q390* probably null Het
Lhfpl2 T A 13: 94,311,003 (GRCm39) F91Y probably damaging Het
Magi1 G A 6: 93,722,654 (GRCm39) T408I probably damaging Het
Mttp T C 3: 137,814,839 (GRCm39) N479D probably damaging Het
Myom3 T C 4: 135,539,770 (GRCm39) V1339A possibly damaging Het
Nin T C 12: 70,077,728 (GRCm39) K1733E probably damaging Het
Or5k1 C A 16: 58,617,894 (GRCm39) C105F probably damaging Het
Pdzrn4 T C 15: 92,575,455 (GRCm39) I287T probably damaging Het
Rpap3 T C 15: 97,579,722 (GRCm39) probably null Het
Scin A G 12: 40,129,714 (GRCm39) Y360H probably benign Het
Sfxn5 A G 6: 85,246,890 (GRCm39) probably null Het
Sgo1 A G 17: 53,986,085 (GRCm39) S369P probably damaging Het
Skil T A 3: 31,152,029 (GRCm39) C184S probably null Het
Srcin1 A G 11: 97,424,653 (GRCm39) M607T possibly damaging Het
Ssc5d C T 7: 4,936,292 (GRCm39) P513S possibly damaging Het
Trip10 A G 17: 57,562,197 (GRCm39) probably null Het
Vmn2r114 T A 17: 23,529,220 (GRCm39) Q294L possibly damaging Het
Zc3h12c A G 9: 52,027,412 (GRCm39) V650A possibly damaging Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161,652,544 (GRCm39) missense probably benign 0.00
IGL00565:Ptprt APN 2 161,402,111 (GRCm39) missense probably damaging 1.00
IGL00925:Ptprt APN 2 161,498,083 (GRCm39) missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161,393,737 (GRCm39) missense probably damaging 1.00
IGL01432:Ptprt APN 2 162,109,999 (GRCm39) splice site probably benign
IGL02008:Ptprt APN 2 161,769,593 (GRCm39) missense probably benign 0.02
IGL02040:Ptprt APN 2 162,079,992 (GRCm39) missense probably damaging 1.00
IGL02172:Ptprt APN 2 161,397,422 (GRCm39) missense probably damaging 1.00
IGL02231:Ptprt APN 2 162,119,966 (GRCm39) critical splice donor site probably null
IGL02231:Ptprt APN 2 162,079,980 (GRCm39) missense probably damaging 1.00
IGL02232:Ptprt APN 2 161,372,437 (GRCm39) missense probably damaging 0.96
IGL02277:Ptprt APN 2 161,389,301 (GRCm39) missense probably damaging 1.00
IGL02447:Ptprt APN 2 162,120,027 (GRCm39) missense probably benign 0.01
IGL02601:Ptprt APN 2 161,608,227 (GRCm39) missense probably benign 0.10
IGL02623:Ptprt APN 2 161,449,372 (GRCm39) splice site probably benign
IGL03379:Ptprt APN 2 161,397,379 (GRCm39) nonsense probably null
Poverina UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161,375,533 (GRCm39) missense probably damaging 0.96
R0064:Ptprt UTSW 2 161,769,711 (GRCm39) splice site probably benign
R0129:Ptprt UTSW 2 162,119,990 (GRCm39) missense probably benign 0.35
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0132:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0316:Ptprt UTSW 2 161,449,239 (GRCm39) missense probably damaging 1.00
R0454:Ptprt UTSW 2 161,395,742 (GRCm39) missense probably damaging 0.96
R0488:Ptprt UTSW 2 161,395,745 (GRCm39) missense probably damaging 0.99
R0573:Ptprt UTSW 2 161,393,668 (GRCm39) missense probably damaging 1.00
R0614:Ptprt UTSW 2 161,654,040 (GRCm39) missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161,654,059 (GRCm39) splice site probably null
R1023:Ptprt UTSW 2 161,400,863 (GRCm39) missense probably damaging 1.00
R1184:Ptprt UTSW 2 161,769,692 (GRCm39) missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162,120,146 (GRCm39) missense probably damaging 1.00
R1476:Ptprt UTSW 2 161,769,404 (GRCm39) missense probably damaging 1.00
R1515:Ptprt UTSW 2 162,079,954 (GRCm39) missense probably damaging 1.00
R1595:Ptprt UTSW 2 161,652,469 (GRCm39) critical splice donor site probably null
R1939:Ptprt UTSW 2 161,769,560 (GRCm39) missense probably benign 0.45
R1987:Ptprt UTSW 2 161,608,241 (GRCm39) missense possibly damaging 0.48
R1987:Ptprt UTSW 2 161,400,818 (GRCm39) missense probably damaging 1.00
R2049:Ptprt UTSW 2 161,376,465 (GRCm39) missense probably damaging 1.00
R2140:Ptprt UTSW 2 161,653,908 (GRCm39) missense probably damaging 1.00
R2421:Ptprt UTSW 2 162,119,960 (GRCm39) splice site probably benign
R3432:Ptprt UTSW 2 161,769,449 (GRCm39) missense probably damaging 1.00
R3619:Ptprt UTSW 2 161,408,077 (GRCm39) missense probably damaging 1.00
R3757:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3758:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3834:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3835:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3915:Ptprt UTSW 2 161,397,475 (GRCm39) splice site probably benign
R4003:Ptprt UTSW 2 161,408,037 (GRCm39) splice site probably benign
R4387:Ptprt UTSW 2 161,769,570 (GRCm39) missense probably damaging 1.00
R4519:Ptprt UTSW 2 161,406,609 (GRCm39) missense probably damaging 1.00
R4618:Ptprt UTSW 2 161,395,765 (GRCm39) missense probably damaging 1.00
R4677:Ptprt UTSW 2 161,743,366 (GRCm39) critical splice donor site probably null
R4866:Ptprt UTSW 2 161,402,159 (GRCm39) missense probably damaging 1.00
R5088:Ptprt UTSW 2 162,080,095 (GRCm39) missense probably benign 0.01
R5173:Ptprt UTSW 2 161,769,676 (GRCm39) missense probably benign 0.01
R5215:Ptprt UTSW 2 162,120,084 (GRCm39) missense probably damaging 1.00
R5383:Ptprt UTSW 2 161,539,969 (GRCm39) missense probably damaging 1.00
R5398:Ptprt UTSW 2 161,769,512 (GRCm39) missense probably damaging 1.00
R5518:Ptprt UTSW 2 162,120,143 (GRCm39) missense probably damaging 0.99
R5711:Ptprt UTSW 2 161,652,524 (GRCm39) missense probably damaging 0.98
R5735:Ptprt UTSW 2 161,376,484 (GRCm39) missense probably damaging 0.98
R5834:Ptprt UTSW 2 161,402,189 (GRCm39) missense probably damaging 1.00
R5872:Ptprt UTSW 2 161,977,138 (GRCm39) missense probably damaging 1.00
R5926:Ptprt UTSW 2 161,406,606 (GRCm39) missense probably benign 0.00
R6210:Ptprt UTSW 2 162,109,949 (GRCm39) missense probably damaging 1.00
R6285:Ptprt UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161,395,779 (GRCm39) missense probably damaging 1.00
R6406:Ptprt UTSW 2 161,395,703 (GRCm39) missense probably damaging 0.98
R6499:Ptprt UTSW 2 161,376,507 (GRCm39) missense probably benign 0.32
R6622:Ptprt UTSW 2 161,395,760 (GRCm39) missense probably damaging 1.00
R7218:Ptprt UTSW 2 161,389,284 (GRCm39) missense probably damaging 1.00
R7247:Ptprt UTSW 2 161,375,443 (GRCm39) missense probably benign 0.15
R7576:Ptprt UTSW 2 161,449,225 (GRCm39) missense possibly damaging 0.88
R7733:Ptprt UTSW 2 161,417,707 (GRCm39) missense probably damaging 1.00
R7735:Ptprt UTSW 2 161,417,661 (GRCm39) missense probably damaging 1.00
R7813:Ptprt UTSW 2 161,372,413 (GRCm39) missense probably damaging 1.00
R8031:Ptprt UTSW 2 161,977,377 (GRCm39) missense probably damaging 1.00
R8074:Ptprt UTSW 2 161,769,581 (GRCm39) missense possibly damaging 0.77
R8151:Ptprt UTSW 2 162,120,005 (GRCm39) missense probably damaging 1.00
R8236:Ptprt UTSW 2 161,528,988 (GRCm39) critical splice donor site probably null
R8308:Ptprt UTSW 2 161,769,566 (GRCm39) missense probably benign 0.00
R8348:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8362:Ptprt UTSW 2 161,393,667 (GRCm39) missense probably damaging 1.00
R8365:Ptprt UTSW 2 161,743,451 (GRCm39) missense probably benign 0.05
R8448:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8512:Ptprt UTSW 2 161,400,783 (GRCm39) missense probably benign 0.00
R8715:Ptprt UTSW 2 161,372,463 (GRCm39) missense probably damaging 1.00
R9004:Ptprt UTSW 2 161,608,314 (GRCm39) missense probably benign 0.04
R9046:Ptprt UTSW 2 161,372,361 (GRCm39) missense possibly damaging 0.58
R9222:Ptprt UTSW 2 161,402,106 (GRCm39) missense probably damaging 1.00
R9297:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9318:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9476:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9510:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9571:Ptprt UTSW 2 161,395,732 (GRCm39) missense probably benign 0.10
X0064:Ptprt UTSW 2 161,769,403 (GRCm39) missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162,080,041 (GRCm39) missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 162,204,868 (GRCm39) missense possibly damaging 0.77
Z1177:Ptprt UTSW 2 161,574,807 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGCAGGAAAGAGAAATTGC -3'
(R):5'- TGGCTCAGACTAAAGTTCGAATG -3'

Sequencing Primer
(F):5'- CCTGCAGGAAAGAGAAATTGCTAAGG -3'
(R):5'- ACTAGGTCTGCTAGGACAGGTACTC -3'
Posted On 2018-06-22