Incidental Mutation 'R6613:Igfbpl1'
ID523755
Institutional Source Beutler Lab
Gene Symbol Igfbpl1
Ensembl Gene ENSMUSG00000035551
Gene Nameinsulin-like growth factor binding protein-like 1
SynonymsIGFBP-like protein, 2810453O06Rik, 2810011G06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R6613 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location45809468-45826923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45813447 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 256 (N256S)
Ref Sequence ENSEMBL: ENSMUSP00000036974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044297]
Predicted Effect probably benign
Transcript: ENSMUST00000044297
AA Change: N256S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000036974
Gene: ENSMUSG00000035551
AA Change: N256S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
IB 28 100 1.31e-3 SMART
KAZAL 82 143 6.59e-14 SMART
IGc2 159 242 5.04e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145102
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 G A 6: 125,806,656 probably null Het
Arfgef1 A T 1: 10,194,396 I475N possibly damaging Het
Atg16l2 C T 7: 101,290,581 probably null Het
Atp2c2 T G 8: 119,756,021 L874R probably damaging Het
C2cd3 T A 7: 100,395,241 S343R possibly damaging Het
C4b A T 17: 34,733,565 S1167T probably damaging Het
Cacna1i G A 15: 80,321,259 G139S probably damaging Het
Chil6 A T 3: 106,389,875 F317I probably benign Het
Cngb1 A T 8: 95,266,010 V199E possibly damaging Het
Dcn A T 10: 97,495,040 T79S probably benign Het
Dcxr A G 11: 120,727,006 V48A probably benign Het
Dnajc13 A T 9: 104,213,877 D668E probably benign Het
Dnajc28 C A 16: 91,616,358 E357* probably null Het
Dock7 A G 4: 98,977,960 Y1198H probably damaging Het
Flot1 A G 17: 35,825,811 D167G probably damaging Het
Gpn1 T C 5: 31,497,352 probably null Het
Hyou1 A T 9: 44,382,498 I242F probably damaging Het
Kif20b C T 19: 34,936,984 Q390* probably null Het
Lhfpl2 T A 13: 94,174,495 F91Y probably damaging Het
Magi1 G A 6: 93,745,673 T408I probably damaging Het
Mttp T C 3: 138,109,078 N479D probably damaging Het
Myom3 T C 4: 135,812,459 V1339A possibly damaging Het
Nin T C 12: 70,030,954 K1733E probably damaging Het
Olfr173 C A 16: 58,797,531 C105F probably damaging Het
Pdzrn4 T C 15: 92,677,574 I287T probably damaging Het
Ptprt A G 2: 161,530,447 V1435A probably damaging Het
Rpap3 T C 15: 97,681,841 probably null Het
Scin A G 12: 40,079,715 Y360H probably benign Het
Sfxn5 A G 6: 85,269,908 probably null Het
Sgo1 A G 17: 53,679,057 S369P probably damaging Het
Skil T A 3: 31,097,880 C184S probably null Het
Srcin1 A G 11: 97,533,827 M607T possibly damaging Het
Ssc5d C T 7: 4,933,293 P513S possibly damaging Het
Trip10 A G 17: 57,255,197 probably null Het
Vmn2r114 T A 17: 23,310,246 Q294L possibly damaging Het
Zc3h12c A G 9: 52,116,112 V650A possibly damaging Het
Other mutations in Igfbpl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Igfbpl1 APN 4 45826478 missense probably damaging 0.99
IGL03339:Igfbpl1 APN 4 45813555 splice site probably benign
PIT1430001:Igfbpl1 UTSW 4 45826756 missense unknown
PIT4504001:Igfbpl1 UTSW 4 45813469 missense possibly damaging 0.86
R1824:Igfbpl1 UTSW 4 45826406 missense probably benign 0.19
R2655:Igfbpl1 UTSW 4 45816289 missense probably damaging 0.96
R3850:Igfbpl1 UTSW 4 45826426 missense probably benign 0.02
R5431:Igfbpl1 UTSW 4 45815588 missense probably benign 0.21
R5695:Igfbpl1 UTSW 4 45826374 missense probably damaging 1.00
R6229:Igfbpl1 UTSW 4 45813517 missense probably damaging 1.00
R6950:Igfbpl1 UTSW 4 45815494 missense probably damaging 1.00
R6954:Igfbpl1 UTSW 4 45826663 missense probably damaging 1.00
R6971:Igfbpl1 UTSW 4 45816333 missense possibly damaging 0.72
R7558:Igfbpl1 UTSW 4 45813497 missense probably damaging 1.00
R7976:Igfbpl1 UTSW 4 45826786 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTTGCCAGCCTTCAGACTG -3'
(R):5'- TAGTGCGTCTGAGAGCAACAAG -3'

Sequencing Primer
(F):5'- AGACTGCCCGCTCTCTG -3'
(R):5'- GTCTGAGAGCAACAAGGACCC -3'
Posted On2018-06-22